Incidental Mutation 'R5277:Kif4-ps'
ID404014
Institutional Source Beutler Lab
Gene Symbol Kif4-ps
Ensembl Gene ENSMUSG00000092054
Gene Namekinesin family member 4, pseudogene
SynonymsKif4b
MMRRC Submission 042864-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R5277 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location101145614-101149758 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 101145927 bp
ZygosityHeterozygous
Amino Acid Change
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185083
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 T C 2: 22,994,648 T54A probably damaging Het
Ablim1 T C 19: 57,155,261 R89G probably damaging Het
Bco1 T A 8: 117,117,389 probably null Het
Bhmt A T 13: 93,624,885 M185K possibly damaging Het
Camk2d T C 3: 126,684,741 probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Dcaf6 A G 1: 165,424,346 S70P probably benign Het
Dclre1a C T 19: 56,544,732 V477I possibly damaging Het
Dnah10 C T 5: 124,828,137 P4021L probably damaging Het
Dusp10 A G 1: 184,037,007 N57D possibly damaging Het
Fam13b G A 18: 34,462,190 R374C probably benign Het
Fyb2 G A 4: 105,015,679 D686N probably damaging Het
Glra3 G A 8: 55,991,207 M67I possibly damaging Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm6180 A G 8: 42,247,140 noncoding transcript Het
Grin2c A G 11: 115,253,813 V629A probably damaging Het
Mc3r T C 2: 172,249,787 F310L probably damaging Het
Myh4 A G 11: 67,252,354 D1036G probably damaging Het
Myh6 A G 14: 54,956,562 I790T probably benign Het
Myo15 C A 11: 60,477,114 Y233* probably null Het
Nckap5 A T 1: 126,026,540 C758* probably null Het
Neurog3 T A 10: 62,133,853 Y36N probably damaging Het
Nlrp4e T C 7: 23,321,438 L450P probably benign Het
Olfr607 A T 7: 103,460,941 L84H probably damaging Het
Otog A G 7: 46,246,621 E170G possibly damaging Het
Ppp2r2b G T 18: 42,741,142 T41K probably damaging Het
Prmt5 A T 14: 54,509,942 D459E probably benign Het
Ric8b G A 10: 84,947,652 V125M probably damaging Het
Rptor A G 11: 119,822,956 S4G probably damaging Het
Rslcan18 T G 13: 67,098,434 E371D probably benign Het
Scaf11 A T 15: 96,419,226 F819Y probably damaging Het
Sema6a A T 18: 47,276,544 probably benign Het
Snx29 C T 16: 11,399,824 T163I possibly damaging Het
Sphkap T C 1: 83,276,164 N1288S probably benign Het
Tmbim7 G A 5: 3,673,192 probably null Het
Tmem63c T A 12: 87,057,757 probably null Het
Tmem69 A G 4: 116,553,261 F171L probably benign Het
Urod A T 4: 116,990,285 probably benign Het
Vmn1r37 A T 6: 66,731,476 I29L probably benign Het
Vmn2r102 A G 17: 19,694,131 T653A possibly damaging Het
Vmn2r75 A C 7: 86,166,292 S121R probably benign Het
Vwde T C 6: 13,186,996 T831A probably benign Het
Wdr70 C T 15: 7,976,984 W362* probably null Het
Zfat A G 15: 68,165,909 C906R probably damaging Het
Zfp7 T C 15: 76,881,203 V32A probably damaging Het
Other mutations in Kif4-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0482:Kif4-ps UTSW 12 101148662 missense probably benign 0.04
R2120:Kif4-ps UTSW 12 101147697 missense probably damaging 1.00
R3421:Kif4-ps UTSW 12 101146971 missense probably damaging 0.96
R3711:Kif4-ps UTSW 12 101146053 missense probably damaging 0.99
R3729:Kif4-ps UTSW 12 101146110 missense probably damaging 1.00
R3883:Kif4-ps UTSW 12 101146214 missense probably damaging 0.97
R4664:Kif4-ps UTSW 12 101149218 exon noncoding transcript
R4712:Kif4-ps UTSW 12 101146275 unclassified noncoding transcript
R4943:Kif4-ps UTSW 12 101149217 exon noncoding transcript
R4974:Kif4-ps UTSW 12 101147071 unclassified noncoding transcript
R5771:Kif4-ps UTSW 12 101149285 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TTCCTTTGTGCCTGGGAAGC -3'
(R):5'- CCCGGATATGTATTTGAGAAGCTC -3'

Sequencing Primer
(F):5'- TTGTGCCTGGGAAGCCTCAG -3'
(R):5'- CTCACAAGGTGAGCATAG -3'
Posted On2016-07-22