Incidental Mutation 'R5277:Myh6'
ID404017
Institutional Source Beutler Lab
Gene Symbol Myh6
Ensembl Gene ENSMUSG00000040752
Gene Namemyosin, heavy polypeptide 6, cardiac muscle, alpha
Synonymsalpha myosin, A830009F23Rik, alpha cardiac MHC, cardiomyopathy, hypertrophic 1, Myhca, Myhc-a, alpha-MHC
MMRRC Submission 042864-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5277 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location54941921-54966927 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54956562 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 790 (I790T)
Ref Sequence ENSEMBL: ENSMUSP00000154634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081857] [ENSMUST00000226297]
Predicted Effect probably benign
Transcript: ENSMUST00000081857
AA Change: I790T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000080538
Gene: ENSMUSG00000040752
AA Change: I790T

DomainStartEndE-ValueType
Pfam:Myosin_N 34 73 1.9e-15 PFAM
MYSc 79 781 N/A SMART
IQ 782 804 1.15e-1 SMART
IQ 808 830 3.32e2 SMART
Pfam:Myosin_tail_1 845 1926 2.1e-162 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131892
Predicted Effect probably benign
Transcript: ENSMUST00000145322
AA Change: I790T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000115326
Gene: ENSMUSG00000040752
AA Change: I790T

DomainStartEndE-ValueType
Pfam:Myosin_N 34 75 5.3e-17 PFAM
MYSc 79 781 N/A SMART
IQ 782 804 1.15e-1 SMART
IQ 808 830 3.32e2 SMART
coiled coil region 842 1112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226297
AA Change: I790T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cardiac muscle myosin is a hexamer consisting of two heavy chain subunits, two light chain subunits, and two regulatory subunits. This gene encodes the alpha heavy chain subunit of cardiac myosin. The gene is located approximately 4kb downstream of the gene encoding the beta heavy chain subunit of cardiac myosin. Mutations in this gene cause familial hypertrophic cardiomyopathy and atrial septal defect 3. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality associated with heart defects while heterozygotes show cardiac myofibrillar disarray, cardiac dysfunction and fibrosis. Mice heterozygous for different knock-in alleles may develop hypertrophic or dilated forms of cardiomyopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 T C 2: 22,994,648 T54A probably damaging Het
Ablim1 T C 19: 57,155,261 R89G probably damaging Het
Bco1 T A 8: 117,117,389 probably null Het
Bhmt A T 13: 93,624,885 M185K possibly damaging Het
Camk2d T C 3: 126,684,741 probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Dcaf6 A G 1: 165,424,346 S70P probably benign Het
Dclre1a C T 19: 56,544,732 V477I possibly damaging Het
Dnah10 C T 5: 124,828,137 P4021L probably damaging Het
Dusp10 A G 1: 184,037,007 N57D possibly damaging Het
Fam13b G A 18: 34,462,190 R374C probably benign Het
Fyb2 G A 4: 105,015,679 D686N probably damaging Het
Glra3 G A 8: 55,991,207 M67I possibly damaging Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm6180 A G 8: 42,247,140 noncoding transcript Het
Grin2c A G 11: 115,253,813 V629A probably damaging Het
Kif4-ps A T 12: 101,145,927 noncoding transcript Het
Mc3r T C 2: 172,249,787 F310L probably damaging Het
Myh4 A G 11: 67,252,354 D1036G probably damaging Het
Myo15 C A 11: 60,477,114 Y233* probably null Het
Nckap5 A T 1: 126,026,540 C758* probably null Het
Neurog3 T A 10: 62,133,853 Y36N probably damaging Het
Nlrp4e T C 7: 23,321,438 L450P probably benign Het
Olfr607 A T 7: 103,460,941 L84H probably damaging Het
Otog A G 7: 46,246,621 E170G possibly damaging Het
Ppp2r2b G T 18: 42,741,142 T41K probably damaging Het
Prmt5 A T 14: 54,509,942 D459E probably benign Het
Ric8b G A 10: 84,947,652 V125M probably damaging Het
Rptor A G 11: 119,822,956 S4G probably damaging Het
Rslcan18 T G 13: 67,098,434 E371D probably benign Het
Scaf11 A T 15: 96,419,226 F819Y probably damaging Het
Sema6a A T 18: 47,276,544 probably benign Het
Snx29 C T 16: 11,399,824 T163I possibly damaging Het
Sphkap T C 1: 83,276,164 N1288S probably benign Het
Tmbim7 G A 5: 3,673,192 probably null Het
Tmem63c T A 12: 87,057,757 probably null Het
Tmem69 A G 4: 116,553,261 F171L probably benign Het
Urod A T 4: 116,990,285 probably benign Het
Vmn1r37 A T 6: 66,731,476 I29L probably benign Het
Vmn2r102 A G 17: 19,694,131 T653A possibly damaging Het
Vmn2r75 A C 7: 86,166,292 S121R probably benign Het
Vwde T C 6: 13,186,996 T831A probably benign Het
Wdr70 C T 15: 7,976,984 W362* probably null Het
Zfat A G 15: 68,165,909 C906R probably damaging Het
Zfp7 T C 15: 76,881,203 V32A probably damaging Het
Other mutations in Myh6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Myh6 APN 14 54946993 missense probably benign 0.13
IGL00401:Myh6 APN 14 54953417 missense probably benign 0.00
IGL01062:Myh6 APN 14 54952292 missense probably damaging 0.99
IGL01300:Myh6 APN 14 54963091 missense possibly damaging 0.94
IGL01688:Myh6 APN 14 54963960 missense possibly damaging 0.74
IGL01695:Myh6 APN 14 54957413 missense probably benign 0.01
IGL01762:Myh6 APN 14 54962081 missense probably benign 0.17
IGL01803:Myh6 APN 14 54944543 missense probably damaging 1.00
IGL02079:Myh6 APN 14 54950541 missense probably damaging 1.00
IGL02315:Myh6 APN 14 54953834 missense probably damaging 1.00
IGL02340:Myh6 APN 14 54957155 missense possibly damaging 0.76
IGL02377:Myh6 APN 14 54944318 missense probably benign 0.10
IGL02715:Myh6 APN 14 54946908 unclassified probably benign
IGL02742:Myh6 APN 14 54953924 missense possibly damaging 0.62
P0028:Myh6 UTSW 14 54963637 missense probably benign
PIT4520001:Myh6 UTSW 14 54950124 missense probably benign 0.00
R0058:Myh6 UTSW 14 54963404 missense probably damaging 1.00
R0090:Myh6 UTSW 14 54958704 missense probably damaging 0.97
R0360:Myh6 UTSW 14 54948347 nonsense probably null
R0364:Myh6 UTSW 14 54948347 nonsense probably null
R0395:Myh6 UTSW 14 54946320 missense possibly damaging 0.94
R0549:Myh6 UTSW 14 54958608 missense probably damaging 1.00
R0559:Myh6 UTSW 14 54958554 missense probably benign
R0800:Myh6 UTSW 14 54953278 splice site probably benign
R0892:Myh6 UTSW 14 54947054 missense probably benign 0.17
R0975:Myh6 UTSW 14 54953369 missense probably damaging 1.00
R1051:Myh6 UTSW 14 54949527 missense probably benign 0.12
R1180:Myh6 UTSW 14 54944468 missense possibly damaging 0.93
R1311:Myh6 UTSW 14 54946365 missense probably damaging 0.96
R1490:Myh6 UTSW 14 54962718 nonsense probably null
R1531:Myh6 UTSW 14 54956506 missense probably damaging 1.00
R1835:Myh6 UTSW 14 54957401 missense probably benign 0.03
R1845:Myh6 UTSW 14 54944674 missense probably damaging 1.00
R2033:Myh6 UTSW 14 54963645 missense probably benign 0.00
R2143:Myh6 UTSW 14 54952954 missense probably damaging 1.00
R2146:Myh6 UTSW 14 54953771 missense probably damaging 1.00
R2155:Myh6 UTSW 14 54953794 missense probably benign
R2484:Myh6 UTSW 14 54961242 nonsense probably null
R3155:Myh6 UTSW 14 54944668 missense probably damaging 0.97
R3156:Myh6 UTSW 14 54944668 missense probably damaging 0.97
R3780:Myh6 UTSW 14 54963958 missense probably benign 0.00
R3906:Myh6 UTSW 14 54956955 missense probably benign 0.04
R3937:Myh6 UTSW 14 54963055 missense probably benign 0.00
R3938:Myh6 UTSW 14 54963055 missense probably benign 0.00
R4236:Myh6 UTSW 14 54960362 missense probably benign 0.15
R4373:Myh6 UTSW 14 54962108 missense probably damaging 0.97
R4374:Myh6 UTSW 14 54962108 missense probably damaging 0.97
R4377:Myh6 UTSW 14 54962108 missense probably damaging 0.97
R4798:Myh6 UTSW 14 54953293 missense probably damaging 1.00
R4844:Myh6 UTSW 14 54947194 missense possibly damaging 0.89
R4908:Myh6 UTSW 14 54956962 missense probably damaging 1.00
R5256:Myh6 UTSW 14 54952661 missense probably damaging 1.00
R5356:Myh6 UTSW 14 54953762 missense probably damaging 1.00
R5433:Myh6 UTSW 14 54953924 missense probably benign 0.32
R5616:Myh6 UTSW 14 54956581 missense probably benign 0.17
R5784:Myh6 UTSW 14 54953064 missense possibly damaging 0.93
R5820:Myh6 UTSW 14 54958680 missense probably damaging 0.99
R5835:Myh6 UTSW 14 54950407 missense probably damaging 1.00
R5922:Myh6 UTSW 14 54946474 missense probably damaging 0.99
R5975:Myh6 UTSW 14 54950508 missense probably benign 0.31
R5988:Myh6 UTSW 14 54965394 missense probably damaging 1.00
R6630:Myh6 UTSW 14 54942001 missense probably benign 0.01
R6845:Myh6 UTSW 14 54944749 missense probably benign
R7009:Myh6 UTSW 14 54952292 missense probably damaging 0.99
R7154:Myh6 UTSW 14 54960307 missense probably benign 0.43
R7293:Myh6 UTSW 14 54947174 missense probably benign 0.00
R7313:Myh6 UTSW 14 54960270 missense probably benign 0.00
R7339:Myh6 UTSW 14 54961568 intron probably null
R7348:Myh6 UTSW 14 54952259 missense probably damaging 1.00
R7487:Myh6 UTSW 14 54953496 nonsense probably null
R7680:Myh6 UTSW 14 54948733 missense possibly damaging 0.88
R7726:Myh6 UTSW 14 54965365 missense probably damaging 0.99
Z1088:Myh6 UTSW 14 54956997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCAGCCTTCTTAAATTCATC -3'
(R):5'- TCCCTGGGAGCTTACTGAAC -3'

Sequencing Primer
(F):5'- GCAGTAGACTCACTTGTCCAC -3'
(R):5'- GGGAGCTTACTGAACATTCTTCCAC -3'
Posted On2016-07-22