Incidental Mutation 'R5277:Vmn2r102'
ID404023
Institutional Source Beutler Lab
Gene Symbol Vmn2r102
Ensembl Gene ENSMUSG00000095961
Gene Namevomeronasal 2, receptor 102
SynonymsEG224572
MMRRC Submission 042864-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5277 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location19660399-19694748 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19694131 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 653 (T653A)
Ref Sequence ENSEMBL: ENSMUSP00000126559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171741]
Predicted Effect possibly damaging
Transcript: ENSMUST00000171741
AA Change: T653A

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126559
Gene: ENSMUSG00000095961
AA Change: T653A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 448 5.2e-38 PFAM
Pfam:NCD3G 509 562 1.1e-21 PFAM
Pfam:7tm_3 595 830 1.8e-53 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 T C 2: 22,994,648 T54A probably damaging Het
Ablim1 T C 19: 57,155,261 R89G probably damaging Het
Bco1 T A 8: 117,117,389 probably null Het
Bhmt A T 13: 93,624,885 M185K possibly damaging Het
Camk2d T C 3: 126,684,741 probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Dcaf6 A G 1: 165,424,346 S70P probably benign Het
Dclre1a C T 19: 56,544,732 V477I possibly damaging Het
Dnah10 C T 5: 124,828,137 P4021L probably damaging Het
Dusp10 A G 1: 184,037,007 N57D possibly damaging Het
Fam13b G A 18: 34,462,190 R374C probably benign Het
Fyb2 G A 4: 105,015,679 D686N probably damaging Het
Glra3 G A 8: 55,991,207 M67I possibly damaging Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm6180 A G 8: 42,247,140 noncoding transcript Het
Grin2c A G 11: 115,253,813 V629A probably damaging Het
Kif4-ps A T 12: 101,145,927 noncoding transcript Het
Mc3r T C 2: 172,249,787 F310L probably damaging Het
Myh4 A G 11: 67,252,354 D1036G probably damaging Het
Myh6 A G 14: 54,956,562 I790T probably benign Het
Myo15 C A 11: 60,477,114 Y233* probably null Het
Nckap5 A T 1: 126,026,540 C758* probably null Het
Neurog3 T A 10: 62,133,853 Y36N probably damaging Het
Nlrp4e T C 7: 23,321,438 L450P probably benign Het
Olfr607 A T 7: 103,460,941 L84H probably damaging Het
Otog A G 7: 46,246,621 E170G possibly damaging Het
Ppp2r2b G T 18: 42,741,142 T41K probably damaging Het
Prmt5 A T 14: 54,509,942 D459E probably benign Het
Ric8b G A 10: 84,947,652 V125M probably damaging Het
Rptor A G 11: 119,822,956 S4G probably damaging Het
Rslcan18 T G 13: 67,098,434 E371D probably benign Het
Scaf11 A T 15: 96,419,226 F819Y probably damaging Het
Sema6a A T 18: 47,276,544 probably benign Het
Snx29 C T 16: 11,399,824 T163I possibly damaging Het
Sphkap T C 1: 83,276,164 N1288S probably benign Het
Tmbim7 G A 5: 3,673,192 probably null Het
Tmem63c T A 12: 87,057,757 probably null Het
Tmem69 A G 4: 116,553,261 F171L probably benign Het
Urod A T 4: 116,990,285 probably benign Het
Vmn1r37 A T 6: 66,731,476 I29L probably benign Het
Vmn2r75 A C 7: 86,166,292 S121R probably benign Het
Vwde T C 6: 13,186,996 T831A probably benign Het
Wdr70 C T 15: 7,976,984 W362* probably null Het
Zfat A G 15: 68,165,909 C906R probably damaging Het
Zfp7 T C 15: 76,881,203 V32A probably damaging Het
Other mutations in Vmn2r102
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Vmn2r102 APN 17 19678892 missense probably damaging 1.00
IGL00974:Vmn2r102 APN 17 19677509 missense possibly damaging 0.93
IGL00978:Vmn2r102 APN 17 19678923 splice site probably null
IGL01589:Vmn2r102 APN 17 19678804 missense probably benign
IGL01738:Vmn2r102 APN 17 19677758 missense probably damaging 1.00
IGL01994:Vmn2r102 APN 17 19660469 missense probably benign 0.00
IGL02066:Vmn2r102 APN 17 19693929 missense probably benign 0.01
IGL02525:Vmn2r102 APN 17 19681185 missense probably benign
IGL02589:Vmn2r102 APN 17 19681218 missense probably damaging 1.00
IGL02814:Vmn2r102 APN 17 19677908 missense probably damaging 1.00
IGL03028:Vmn2r102 APN 17 19694066 missense possibly damaging 0.92
IGL03162:Vmn2r102 APN 17 19694024 missense probably damaging 1.00
PIT4431001:Vmn2r102 UTSW 17 19676696 missense possibly damaging 0.68
R0042:Vmn2r102 UTSW 17 19660589 missense probably damaging 0.98
R0131:Vmn2r102 UTSW 17 19678763 missense probably benign 0.42
R0131:Vmn2r102 UTSW 17 19678763 missense probably benign 0.42
R0132:Vmn2r102 UTSW 17 19678763 missense probably benign 0.42
R0268:Vmn2r102 UTSW 17 19677850 missense probably benign 0.00
R0441:Vmn2r102 UTSW 17 19694368 missense probably damaging 1.00
R0583:Vmn2r102 UTSW 17 19676781 missense probably benign 0.01
R0600:Vmn2r102 UTSW 17 19678015 missense probably benign 0.00
R0606:Vmn2r102 UTSW 17 19678844 missense possibly damaging 0.93
R0674:Vmn2r102 UTSW 17 19677867 missense probably benign 0.00
R0709:Vmn2r102 UTSW 17 19677619 missense probably benign 0.01
R0879:Vmn2r102 UTSW 17 19694192 missense probably damaging 1.00
R1349:Vmn2r102 UTSW 17 19660625 splice site probably benign
R1473:Vmn2r102 UTSW 17 19694581 missense probably benign 0.00
R1630:Vmn2r102 UTSW 17 19678770 missense possibly damaging 0.60
R1727:Vmn2r102 UTSW 17 19677508 missense probably damaging 0.99
R1759:Vmn2r102 UTSW 17 19694493 missense probably damaging 1.00
R1809:Vmn2r102 UTSW 17 19677619 missense probably benign 0.01
R2013:Vmn2r102 UTSW 17 19676744 missense probably benign 0.03
R2086:Vmn2r102 UTSW 17 19676687 missense probably damaging 1.00
R2241:Vmn2r102 UTSW 17 19676741 missense probably benign 0.00
R2378:Vmn2r102 UTSW 17 19694668 missense probably damaging 1.00
R3814:Vmn2r102 UTSW 17 19678831 missense probably damaging 0.98
R3827:Vmn2r102 UTSW 17 19694525 missense probably damaging 1.00
R4159:Vmn2r102 UTSW 17 19677826 missense probably damaging 1.00
R4505:Vmn2r102 UTSW 17 19660583 missense probably benign 0.00
R4515:Vmn2r102 UTSW 17 19681213 missense probably damaging 1.00
R4517:Vmn2r102 UTSW 17 19681213 missense probably damaging 1.00
R4534:Vmn2r102 UTSW 17 19694713 missense probably benign
R4535:Vmn2r102 UTSW 17 19694713 missense probably benign
R4662:Vmn2r102 UTSW 17 19681162 missense probably damaging 1.00
R4708:Vmn2r102 UTSW 17 19694314 missense probably benign 0.00
R4734:Vmn2r102 UTSW 17 19677533 missense probably damaging 1.00
R4834:Vmn2r102 UTSW 17 19677941 missense probably damaging 0.99
R4927:Vmn2r102 UTSW 17 19660399 start codon destroyed probably benign 0.00
R5077:Vmn2r102 UTSW 17 19677572 missense probably benign 0.20
R5181:Vmn2r102 UTSW 17 19676741 missense probably benign 0.00
R5418:Vmn2r102 UTSW 17 19694153 missense probably damaging 1.00
R5810:Vmn2r102 UTSW 17 19677542 missense probably benign 0.20
R5864:Vmn2r102 UTSW 17 19694681 missense possibly damaging 0.55
R6168:Vmn2r102 UTSW 17 19694140 missense possibly damaging 0.83
R6266:Vmn2r102 UTSW 17 19678745 missense probably benign
R6432:Vmn2r102 UTSW 17 19681221 missense possibly damaging 0.61
R6487:Vmn2r102 UTSW 17 19677907 missense probably damaging 1.00
R6597:Vmn2r102 UTSW 17 19694188 missense probably damaging 0.99
R6797:Vmn2r102 UTSW 17 19660432 nonsense probably null
R7009:Vmn2r102 UTSW 17 19694194 missense probably damaging 0.99
R7098:Vmn2r102 UTSW 17 19694408 missense probably damaging 1.00
R7134:Vmn2r102 UTSW 17 19677487 missense probably benign 0.01
R7463:Vmn2r102 UTSW 17 19676624 missense probably damaging 1.00
R7511:Vmn2r102 UTSW 17 19681143 missense probably damaging 1.00
R7512:Vmn2r102 UTSW 17 19694101 missense probably damaging 1.00
R7556:Vmn2r102 UTSW 17 19677831 missense probably benign
R8126:Vmn2r102 UTSW 17 19660450 missense probably benign 0.02
R8385:Vmn2r102 UTSW 17 19693826 missense possibly damaging 0.89
R8410:Vmn2r102 UTSW 17 19677934 missense possibly damaging 0.85
Z1176:Vmn2r102 UTSW 17 19694043 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTCTAGCCAGTATAGCTTTGTG -3'
(R):5'- ATGGTGGAGAGGTTGCCATC -3'

Sequencing Primer
(F):5'- GCTTTGTGCTTATCTTCACTCACAG -3'
(R):5'- GGAGAGGTTGCCATCCATATTCC -3'
Posted On2016-07-22