Incidental Mutation 'R5277:Ppp2r2b'
ID404025
Institutional Source Beutler Lab
Gene Symbol Ppp2r2b
Ensembl Gene ENSMUSG00000024500
Gene Nameprotein phosphatase 2, regulatory subunit B, beta
SynonymsSCA12, 6330404L05Rik, 2900026H06Rik, E130009M08Rik, PR55-BETA, PP2A-PR55B
MMRRC Submission 042864-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5277 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location42637432-43059471 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 42741142 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 41 (T41K)
Ref Sequence ENSEMBL: ENSMUSP00000113411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025377] [ENSMUST00000117687] [ENSMUST00000120632]
Predicted Effect probably damaging
Transcript: ENSMUST00000025377
AA Change: T44K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025377
Gene: ENSMUSG00000024500
AA Change: T44K

DomainStartEndE-ValueType
WD40 14 55 6.42e-1 SMART
WD40 82 122 3.7e0 SMART
WD40 164 203 1.66e0 SMART
WD40 214 254 1.38e1 SMART
WD40 273 311 5.7e1 SMART
Blast:WD40 315 369 6e-26 BLAST
WD40 405 442 1.33e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117687
AA Change: T41K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113731
Gene: ENSMUSG00000024500
AA Change: T41K

DomainStartEndE-ValueType
WD40 13 52 1.92e0 SMART
WD40 79 119 3.7e0 SMART
WD40 161 200 1.66e0 SMART
WD40 211 251 1.38e1 SMART
WD40 270 308 5.7e1 SMART
Blast:WD40 312 366 4e-26 BLAST
WD40 402 439 1.33e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120632
AA Change: T41K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113411
Gene: ENSMUSG00000024500
AA Change: T41K

DomainStartEndE-ValueType
WD40 13 52 1.92e0 SMART
WD40 79 119 3.7e0 SMART
WD40 161 200 1.66e0 SMART
WD40 211 251 1.38e1 SMART
WD40 270 308 5.7e1 SMART
Blast:WD40 312 366 4e-26 BLAST
WD40 402 439 1.33e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136118
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153737
Meta Mutation Damage Score 0.8570 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a beta isoform of the regulatory subunit B55 subfamily. Defects in this gene cause autosomal dominant spinocerebellar ataxia 12 (SCA12), a disease caused by degeneration of the cerebellum, sometimes involving the brainstem and spinal cord, and in resulting in poor coordination of speech and body movements. Multiple alternatively spliced variants, which encode different isoforms, have been identified for this gene. The 5' UTR of some of these variants includes a CAG trinucleotide repeat sequence (7-28 copies) that can be expanded to 55-78 copies in cases of SCA12. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 T C 2: 22,994,648 T54A probably damaging Het
Ablim1 T C 19: 57,155,261 R89G probably damaging Het
Bco1 T A 8: 117,117,389 probably null Het
Bhmt A T 13: 93,624,885 M185K possibly damaging Het
Camk2d T C 3: 126,684,741 probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Dcaf6 A G 1: 165,424,346 S70P probably benign Het
Dclre1a C T 19: 56,544,732 V477I possibly damaging Het
Dnah10 C T 5: 124,828,137 P4021L probably damaging Het
Dusp10 A G 1: 184,037,007 N57D possibly damaging Het
Fam13b G A 18: 34,462,190 R374C probably benign Het
Fyb2 G A 4: 105,015,679 D686N probably damaging Het
Glra3 G A 8: 55,991,207 M67I possibly damaging Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm6180 A G 8: 42,247,140 noncoding transcript Het
Grin2c A G 11: 115,253,813 V629A probably damaging Het
Kif4-ps A T 12: 101,145,927 noncoding transcript Het
Mc3r T C 2: 172,249,787 F310L probably damaging Het
Myh4 A G 11: 67,252,354 D1036G probably damaging Het
Myh6 A G 14: 54,956,562 I790T probably benign Het
Myo15 C A 11: 60,477,114 Y233* probably null Het
Nckap5 A T 1: 126,026,540 C758* probably null Het
Neurog3 T A 10: 62,133,853 Y36N probably damaging Het
Nlrp4e T C 7: 23,321,438 L450P probably benign Het
Olfr607 A T 7: 103,460,941 L84H probably damaging Het
Otog A G 7: 46,246,621 E170G possibly damaging Het
Prmt5 A T 14: 54,509,942 D459E probably benign Het
Ric8b G A 10: 84,947,652 V125M probably damaging Het
Rptor A G 11: 119,822,956 S4G probably damaging Het
Rslcan18 T G 13: 67,098,434 E371D probably benign Het
Scaf11 A T 15: 96,419,226 F819Y probably damaging Het
Sema6a A T 18: 47,276,544 probably benign Het
Snx29 C T 16: 11,399,824 T163I possibly damaging Het
Sphkap T C 1: 83,276,164 N1288S probably benign Het
Tmbim7 G A 5: 3,673,192 probably null Het
Tmem63c T A 12: 87,057,757 probably null Het
Tmem69 A G 4: 116,553,261 F171L probably benign Het
Urod A T 4: 116,990,285 probably benign Het
Vmn1r37 A T 6: 66,731,476 I29L probably benign Het
Vmn2r102 A G 17: 19,694,131 T653A possibly damaging Het
Vmn2r75 A C 7: 86,166,292 S121R probably benign Het
Vwde T C 6: 13,186,996 T831A probably benign Het
Wdr70 C T 15: 7,976,984 W362* probably null Het
Zfat A G 15: 68,165,909 C906R probably damaging Het
Zfp7 T C 15: 76,881,203 V32A probably damaging Het
Other mutations in Ppp2r2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Ppp2r2b APN 18 42645775 missense probably damaging 0.99
IGL01999:Ppp2r2b APN 18 42645723 utr 3 prime probably benign
IGL02610:Ppp2r2b APN 18 42648775 splice site probably benign
IGL02733:Ppp2r2b APN 18 42648728 missense possibly damaging 0.96
IGL02899:Ppp2r2b APN 18 42645809 missense probably damaging 1.00
Degradation UTSW 18 42688338 missense probably benign 0.27
R0737:Ppp2r2b UTSW 18 43059192 missense probably benign
R1459:Ppp2r2b UTSW 18 42737990 missense probably damaging 1.00
R1616:Ppp2r2b UTSW 18 42688310 missense probably benign 0.32
R1635:Ppp2r2b UTSW 18 43059210 missense probably benign 0.01
R3435:Ppp2r2b UTSW 18 42741109 missense possibly damaging 0.48
R4204:Ppp2r2b UTSW 18 42738050 missense probably benign
R4301:Ppp2r2b UTSW 18 42898746 missense probably null
R5062:Ppp2r2b UTSW 18 42688461 missense possibly damaging 0.48
R5147:Ppp2r2b UTSW 18 42645877 missense probably benign 0.00
R5207:Ppp2r2b UTSW 18 42688352 missense probably damaging 1.00
R6004:Ppp2r2b UTSW 18 43059159 splice site probably null
R6528:Ppp2r2b UTSW 18 42688338 missense probably benign 0.27
R6735:Ppp2r2b UTSW 18 42688588 splice site probably null
R7521:Ppp2r2b UTSW 18 43059177 missense probably benign
R7831:Ppp2r2b UTSW 18 42701532 missense probably benign
R8405:Ppp2r2b UTSW 18 42645740 missense probably benign 0.00
Z1177:Ppp2r2b UTSW 18 42648693 missense probably benign 0.04
Z1177:Ppp2r2b UTSW 18 42688423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCTTGAACTTAGAACTGTGG -3'
(R):5'- CCCAACTGCTACTTCAAGTGG -3'

Sequencing Primer
(F):5'- CTTAGAACTGTGGATGCTAATGAC -3'
(R):5'- GCTACTTCAAGTGGTACTTAAAATGC -3'
Posted On2016-07-22