Mutagenetix > Incidental Mutations

Incidental Mutation 'R5277:Dclre1a'

404027

Institutional Source

Beutler Lab

Gene Symbol

Dclre1a

Ensembl Gene

ENSMUSG00000025077

Gene Name

DNA cross-link repair 1A

Synonyms

2810043H12Rik, SMN1a, SNM1, mSNM1

MMRRC Submission

042864-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5277 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

56529167-56548222 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 56544732 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 477 (V477I)

Ref Sequence

ENSEMBL: ENSMUSP00000138290 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071423] [ENSMUST00000182059] [ENSMUST00000182276] [ENSMUST00000183143]

Predicted Effect

probably benign
Transcript: ENSMUST00000071423

SMART Domains

Protein: ENSMUSP00000071370
Gene: ENSMUSG00000025078

Domain	Start	End	E-Value	Type
Pfam:Thioredoxin_8	78	174	2.7e-14	PFAM
LY	216	258	8.44e0	SMART
Pfam:NHL	278	304	2.3e-9	PFAM
low complexity region	321	331	N/A	INTRINSIC
Blast:LY	402	446	5e-8	BLAST
LY	467	509	1.91e0	SMART
Pfam:NHL	530	558	1.2e-9	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181992

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182058

Predicted Effect

probably benign
Transcript: ENSMUST00000182059

Predicted Effect

possibly damaging
Transcript: ENSMUST00000182276
AA Change: V477I

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000138290
Gene: ENSMUSG00000025077
AA Change: V477I

Domain	Start	End	E-Value	Type
low complexity region	90	110	N/A	INTRINSIC
low complexity region	211	220	N/A	INTRINSIC
low complexity region	546	560	N/A	INTRINSIC
Lactamase_B	705	853	7.86e-1	SMART
Pfam:DRMBL	921	1027	1e-38	PFAM

Predicted Effect

silent
Transcript: ENSMUST00000183143

SMART Domains

Protein: ENSMUSP00000138537
Gene: ENSMUSG00000025077

Domain	Start	End	E-Value	Type
low complexity region	90	110	N/A	INTRINSIC

Meta Mutation Damage Score

0.0638

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved protein that is involved in the repair of DNA interstrand cross-links. DNA cross-links suppress transcription, replication, and DNA segregation. The encoded protein is a regulator of the mitotic cell cycle checkpoint. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile but exhibit increased sensitivity to the DNA interstrand cross-linking agent mitomycin C. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi1	T	C	2: 22,994,648	T54A	probably damaging	Het
Ablim1	T	C	19: 57,155,261	R89G	probably damaging	Het
Bco1	T	A	8: 117,117,389		probably null	Het
Bhmt	A	T	13: 93,624,885	M185K	possibly damaging	Het
Camk2d	T	C	3: 126,684,741		probably benign	Het
Cmtm1	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	8: 104,309,470		probably benign	Het
Dcaf6	A	G	1: 165,424,346	S70P	probably benign	Het
Dnah10	C	T	5: 124,828,137	P4021L	probably damaging	Het
Dusp10	A	G	1: 184,037,007	N57D	possibly damaging	Het
Fam13b	G	A	18: 34,462,190	R374C	probably benign	Het
Fyb2	G	A	4: 105,015,679	D686N	probably damaging	Het
Glra3	G	A	8: 55,991,207	M67I	possibly damaging	Het
Gm14325	G	A	2: 177,832,984	H102Y	possibly damaging	Het
Gm6180	A	G	8: 42,247,140		noncoding transcript	Het
Grin2c	A	G	11: 115,253,813	V629A	probably damaging	Het
Kif4-ps	A	T	12: 101,145,927		noncoding transcript	Het
Mc3r	T	C	2: 172,249,787	F310L	probably damaging	Het
Myh4	A	G	11: 67,252,354	D1036G	probably damaging	Het
Myh6	A	G	14: 54,956,562	I790T	probably benign	Het
Myo15	C	A	11: 60,477,114	Y233*	probably null	Het
Nckap5	A	T	1: 126,026,540	C758*	probably null	Het
Neurog3	T	A	10: 62,133,853	Y36N	probably damaging	Het
Nlrp4e	T	C	7: 23,321,438	L450P	probably benign	Het
Olfr607	A	T	7: 103,460,941	L84H	probably damaging	Het
Otog	A	G	7: 46,246,621	E170G	possibly damaging	Het
Ppp2r2b	G	T	18: 42,741,142	T41K	probably damaging	Het
Prmt5	A	T	14: 54,509,942	D459E	probably benign	Het
Ric8b	G	A	10: 84,947,652	V125M	probably damaging	Het
Rptor	A	G	11: 119,822,956	S4G	probably damaging	Het
Rslcan18	T	G	13: 67,098,434	E371D	probably benign	Het
Scaf11	A	T	15: 96,419,226	F819Y	probably damaging	Het
Sema6a	A	T	18: 47,276,544		probably benign	Het
Snx29	C	T	16: 11,399,824	T163I	possibly damaging	Het
Sphkap	T	C	1: 83,276,164	N1288S	probably benign	Het
Tmbim7	G	A	5: 3,673,192		probably null	Het
Tmem63c	T	A	12: 87,057,757		probably null	Het
Tmem69	A	G	4: 116,553,261	F171L	probably benign	Het
Urod	A	T	4: 116,990,285		probably benign	Het
Vmn1r37	A	T	6: 66,731,476	I29L	probably benign	Het
Vmn2r102	A	G	17: 19,694,131	T653A	possibly damaging	Het
Vmn2r75	A	C	7: 86,166,292	S121R	probably benign	Het
Vwde	T	C	6: 13,186,996	T831A	probably benign	Het
Wdr70	C	T	15: 7,976,984	W362*	probably null	Het
Zfat	A	G	15: 68,165,909	C906R	probably damaging	Het
Zfp7	T	C	15: 76,881,203	V32A	probably damaging	Het

Other mutations in Dclre1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01655:Dclre1a	APN	19	56547057	missense	probably damaging	1.00
IGL02113:Dclre1a	APN	19	56541532	missense	probably damaging	0.98
IGL02264:Dclre1a	APN	19	56544293	missense	possibly damaging	0.93
IGL03303:Dclre1a	APN	19	56546766	missense	possibly damaging	0.85
Gof	UTSW	19	56542709	missense	probably damaging	1.00
Hoopla	UTSW	19	56546635	critical splice donor site	probably null
FR4589:Dclre1a	UTSW	19	56544123	utr 3 prime	probably benign
PIT4377001:Dclre1a	UTSW	19	56544405	missense	probably benign	0.05
R0081:Dclre1a	UTSW	19	56542707	missense	probably damaging	1.00
R0355:Dclre1a	UTSW	19	56546635	critical splice donor site	probably null
R0422:Dclre1a	UTSW	19	56544135	nonsense	probably null
R0486:Dclre1a	UTSW	19	56541490	splice site	probably benign
R0619:Dclre1a	UTSW	19	56545409	missense	probably benign	0.00
R0639:Dclre1a	UTSW	19	56538440	missense	probably damaging	1.00
R1221:Dclre1a	UTSW	19	56531268	missense	possibly damaging	0.69
R1352:Dclre1a	UTSW	19	56545163	missense	probably damaging	1.00
R1824:Dclre1a	UTSW	19	56546718	unclassified	probably null
R1833:Dclre1a	UTSW	19	56541500	splice site	probably null
R3851:Dclre1a	UTSW	19	56541507	missense	probably damaging	1.00
R3889:Dclre1a	UTSW	19	56545320	missense	probably benign	0.00
R4373:Dclre1a	UTSW	19	56545442	missense	probably benign	0.04
R5747:Dclre1a	UTSW	19	56541532	missense	probably damaging	0.98
R5792:Dclre1a	UTSW	19	56529590	missense	probably damaging	1.00
R5892:Dclre1a	UTSW	19	56547140	missense	probably benign	0.29
R5993:Dclre1a	UTSW	19	56542737	missense	probably damaging	1.00
R6368:Dclre1a	UTSW	19	56546791	missense	probably benign	0.02
R6706:Dclre1a	UTSW	19	56545069	missense	probably benign	0.11
R6944:Dclre1a	UTSW	19	56545019	missense	possibly damaging	0.90
R6960:Dclre1a	UTSW	19	56542709	missense	probably damaging	1.00
R7023:Dclre1a	UTSW	19	56540206	missense	probably damaging	0.99
R7213:Dclre1a	UTSW	19	56529635	missense	probably damaging	1.00
R7355:Dclre1a	UTSW	19	56547135	missense	possibly damaging	0.53
R7413:Dclre1a	UTSW	19	56542650	missense	probably damaging	1.00
R7577:Dclre1a	UTSW	19	56529533	missense	probably damaging	1.00
RF031:Dclre1a	UTSW	19	56544132	utr 3 prime	probably benign
RF046:Dclre1a	UTSW	19	56544132	utr 3 prime	probably benign

Predicted Primers

PCR Primer
(F):5'- CATGCTAGAGCGCTTCTGTG -3'
(R):5'- GTACACTAAGTGACTCTTTTCTGC -3'

Sequencing Primer
(F):5'- CTTTGGGTTGGATGCAAAG -3'
(R):5'- TCGAACAGGCTTTCCCAAG -3'

Posted On

2016-07-22