Incidental Mutation 'R5278:Jade1'
ID404034
Institutional Source Beutler Lab
Gene Symbol Jade1
Ensembl Gene ENSMUSG00000025764
Gene Namejade family PHD finger 1
SynonymsD530048A03Rik, Phf17
MMRRC Submission 042865-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5278 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location41555731-41616864 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 41589009 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 43 (R43L)
Ref Sequence ENSEMBL: ENSMUSP00000141499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026865] [ENSMUST00000163764] [ENSMUST00000168086] [ENSMUST00000170711] [ENSMUST00000191952] [ENSMUST00000194181] [ENSMUST00000195846]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026865
AA Change: R43L

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000026865
Gene: ENSMUSG00000025764
AA Change: R43L

DomainStartEndE-ValueType
Pfam:EPL1 31 182 5.3e-23 PFAM
PHD 206 252 1.91e-10 SMART
PHD 315 370 1.31e-8 SMART
low complexity region 622 634 N/A INTRINSIC
low complexity region 817 831 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163764
AA Change: R43L

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128152
Gene: ENSMUSG00000025764
AA Change: R43L

DomainStartEndE-ValueType
Pfam:EPL1 31 182 5.3e-23 PFAM
PHD 206 252 1.91e-10 SMART
PHD 315 370 1.31e-8 SMART
low complexity region 622 634 N/A INTRINSIC
low complexity region 817 831 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000168086
AA Change: R43L

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131441
Gene: ENSMUSG00000025764
AA Change: R43L

DomainStartEndE-ValueType
Pfam:EPL1 31 182 5.3e-23 PFAM
PHD 206 252 1.91e-10 SMART
PHD 315 370 1.31e-8 SMART
low complexity region 622 634 N/A INTRINSIC
low complexity region 817 831 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170711
AA Change: R43L

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127113
Gene: ENSMUSG00000025764
AA Change: R43L

DomainStartEndE-ValueType
Pfam:EPL1 5 182 1.5e-9 PFAM
PHD 206 252 1.91e-10 SMART
PHD 315 370 1.31e-8 SMART
low complexity region 622 634 N/A INTRINSIC
low complexity region 817 831 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191921
Predicted Effect possibly damaging
Transcript: ENSMUST00000191952
AA Change: R43L

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141499
Gene: ENSMUSG00000025764
AA Change: R43L

DomainStartEndE-ValueType
Pfam:EPL1 30 182 2.3e-23 PFAM
PHD 206 252 1.91e-10 SMART
PHD 315 370 1.31e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193080
Predicted Effect possibly damaging
Transcript: ENSMUST00000194181
AA Change: R43L

PolyPhen 2 Score 0.625 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141670
Gene: ENSMUSG00000025764
AA Change: R43L

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195200
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195322
Predicted Effect possibly damaging
Transcript: ENSMUST00000195846
AA Change: R43L

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141711
Gene: ENSMUSG00000025764
AA Change: R43L

DomainStartEndE-ValueType
Pfam:EPL1 29 152 6e-12 PFAM
Meta Mutation Damage Score 0.0904 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 98% (50/51)
MGI Phenotype PHENOTYPE: Though mice homozygous for mutations of this locus show no overt phenotype at birth, fewer survive to weaning than expected by Mendelian ratios. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 C T 5: 35,588,156 probably benign Het
Acvr2b G A 9: 119,432,489 V383I probably damaging Het
Akap12 T C 10: 4,354,792 M534T probably benign Het
Akp3 G A 1: 87,125,166 E26K probably benign Het
Alcam A G 16: 52,274,275 I371T probably benign Het
Ap2a1 T C 7: 44,902,779 T794A probably benign Het
Apeh G A 9: 108,091,258 P349S probably benign Het
Asb7 G T 7: 66,679,185 Q36K possibly damaging Het
Asl A G 5: 130,018,831 probably null Het
Atp13a2 T A 4: 141,000,818 I574N probably damaging Het
Bcl2l2 T A 14: 54,884,794 I138N probably damaging Het
Cacna1d C T 14: 30,352,924 probably null Het
Ccdc9 C T 7: 16,278,381 W1* probably null Het
Cdh18 T A 15: 23,474,158 S705T probably benign Het
Ces5a A T 8: 93,525,638 W209R probably damaging Het
Chpf2 T A 5: 24,588,090 probably benign Het
Cul9 T A 17: 46,510,873 H1892L probably damaging Het
Cxcl13 A G 5: 95,958,727 T53A probably benign Het
Cyp2s1 T A 7: 25,805,884 Y385F possibly damaging Het
Ddx46 A G 13: 55,676,038 E915G probably damaging Het
Dirc2 A G 16: 35,697,988 S452P probably damaging Het
Elovl3 G A 19: 46,134,101 V113I probably benign Het
Fam53c A T 18: 34,762,618 probably benign Het
Fbxw15 A T 9: 109,555,684 F349L probably benign Het
Fuz C T 7: 44,896,277 P9L probably benign Het
Igf1r C T 7: 68,193,418 T759M possibly damaging Het
Impg2 G A 16: 56,221,517 D175N probably benign Het
Kntc1 A G 5: 123,781,014 E816G probably damaging Het
Mettl8 A T 2: 70,973,297 D262E probably damaging Het
Mrpl48 A G 7: 100,552,583 V156A probably damaging Het
Mst1 A C 9: 108,082,215 K233N probably damaging Het
Myh13 A G 11: 67,334,564 I252V probably benign Het
Nox4 T C 7: 87,371,926 W449R probably damaging Het
Olfr167 A T 16: 19,515,378 L86* probably null Het
Olfr437 T C 6: 43,167,721 L221P probably damaging Het
Pank4 T C 4: 154,972,165 L351P probably damaging Het
Pappa2 A T 1: 158,782,403 probably null Het
Peg10 CCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATCC CCATCAGGATGCACATCAGGATCC 6: 4,756,442 probably benign Het
Polr3e T A 7: 120,922,961 I10K possibly damaging Het
Prkdc T C 16: 15,714,974 I1489T probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sh3pxd2b A G 11: 32,381,447 D57G probably damaging Het
Shank2 G A 7: 144,068,875 probably null Het
Slc15a4 A T 5: 127,616,969 V134E probably damaging Het
Stxbp5l G T 16: 37,186,654 Q726K probably benign Het
Tesk2 T G 4: 116,805,936 probably benign Het
Tex2 A G 11: 106,567,813 S264P probably benign Het
Tnik A G 3: 28,650,060 Q1003R probably damaging Het
Trip12 C T 1: 84,762,147 R628H probably damaging Het
Vmn2r69 G A 7: 85,411,783 H198Y probably benign Het
Other mutations in Jade1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01482:Jade1 APN 3 41613502 missense probably benign 0.01
IGL01564:Jade1 APN 3 41596649 missense possibly damaging 0.91
IGL02428:Jade1 APN 3 41613939 missense probably benign 0.03
IGL03080:Jade1 APN 3 41600075 nonsense probably null
R0763:Jade1 UTSW 3 41613783 missense possibly damaging 0.93
R1539:Jade1 UTSW 3 41604996 missense probably benign 0.00
R1576:Jade1 UTSW 3 41591807 missense probably damaging 1.00
R1826:Jade1 UTSW 3 41613213 missense probably damaging 1.00
R2143:Jade1 UTSW 3 41604708 missense probably benign
R2255:Jade1 UTSW 3 41591750 missense probably damaging 1.00
R2843:Jade1 UTSW 3 41604845 missense probably damaging 0.98
R2962:Jade1 UTSW 3 41613327 missense probably benign
R3963:Jade1 UTSW 3 41601410 missense probably damaging 0.98
R4753:Jade1 UTSW 3 41596671 nonsense probably null
R4971:Jade1 UTSW 3 41601401 missense probably damaging 1.00
R5327:Jade1 UTSW 3 41613978 missense possibly damaging 0.60
R5384:Jade1 UTSW 3 41591702 missense probably damaging 1.00
R5385:Jade1 UTSW 3 41591702 missense probably damaging 1.00
R5531:Jade1 UTSW 3 41613511 missense probably benign 0.27
R5566:Jade1 UTSW 3 41604903 missense possibly damaging 0.77
R5776:Jade1 UTSW 3 41613792 missense probably benign 0.27
R6299:Jade1 UTSW 3 41613725 missense probably damaging 1.00
R6520:Jade1 UTSW 3 41604482 missense possibly damaging 0.46
R7481:Jade1 UTSW 3 41604690 missense probably benign
R8006:Jade1 UTSW 3 41613689 missense probably benign
X0026:Jade1 UTSW 3 41613413 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACCTCTTGACAGCTCAGTGAC -3'
(R):5'- TGCAACAAGGCACACATCTG -3'

Sequencing Primer
(F):5'- TGACTTTCTGAGACAAGGCC -3'
(R):5'- AAGGCACACATCTGCTTCTC -3'
Posted On2016-07-22