Incidental Mutation 'R5278:Pank4'
ID404036
Institutional Source Beutler Lab
Gene Symbol Pank4
Ensembl Gene ENSMUSG00000029056
Gene Namepantothenate kinase 4
SynonymsD030031I12Rik
MMRRC Submission 042865-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R5278 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location154964123-154980938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 154972165 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 351 (L351P)
Ref Sequence ENSEMBL: ENSMUSP00000064330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030931] [ENSMUST00000070953]
Predicted Effect probably damaging
Transcript: ENSMUST00000030931
AA Change: L351P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030931
Gene: ENSMUSG00000029056
AA Change: L351P

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
Pfam:Fumble 35 369 1.5e-142 PFAM
low complexity region 415 428 N/A INTRINSIC
Pfam:DUF89 451 763 1.4e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000070953
AA Change: L351P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064330
Gene: ENSMUSG00000029056
AA Change: L351P

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
Pfam:Fumble 36 367 1.8e-133 PFAM
low complexity region 415 428 N/A INTRINSIC
Pfam:DUF89 451 810 3.1e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148299
Predicted Effect unknown
Transcript: ENSMUST00000148934
AA Change: L208P
SMART Domains Protein: ENSMUSP00000125663
Gene: ENSMUSG00000029056
AA Change: L208P

DomainStartEndE-ValueType
Pfam:Fumble 1 225 2.6e-103 PFAM
low complexity region 273 286 N/A INTRINSIC
Pfam:DUF89 309 472 1.9e-30 PFAM
Meta Mutation Damage Score 0.8786 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the pantothenate kinase family. Pantothenate kinase is a key regulatory enzyme in the biosynthesis of coenzyme A (CoA) in bacteria and mammalian cells. It catalyzes the first committed step in the universal biosynthetic pathway leading to CoA and is itself subject to regulation through feedback inhibition by CoA. This family member is most abundant in muscle but is expressed in all tissues. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 C T 5: 35,588,156 probably benign Het
Acvr2b G A 9: 119,432,489 V383I probably damaging Het
Akap12 T C 10: 4,354,792 M534T probably benign Het
Akp3 G A 1: 87,125,166 E26K probably benign Het
Alcam A G 16: 52,274,275 I371T probably benign Het
Ap2a1 T C 7: 44,902,779 T794A probably benign Het
Apeh G A 9: 108,091,258 P349S probably benign Het
Asb7 G T 7: 66,679,185 Q36K possibly damaging Het
Asl A G 5: 130,018,831 probably null Het
Atp13a2 T A 4: 141,000,818 I574N probably damaging Het
Bcl2l2 T A 14: 54,884,794 I138N probably damaging Het
Cacna1d C T 14: 30,352,924 probably null Het
Ccdc9 C T 7: 16,278,381 W1* probably null Het
Cdh18 T A 15: 23,474,158 S705T probably benign Het
Ces5a A T 8: 93,525,638 W209R probably damaging Het
Chpf2 T A 5: 24,588,090 probably benign Het
Cul9 T A 17: 46,510,873 H1892L probably damaging Het
Cxcl13 A G 5: 95,958,727 T53A probably benign Het
Cyp2s1 T A 7: 25,805,884 Y385F possibly damaging Het
Ddx46 A G 13: 55,676,038 E915G probably damaging Het
Dirc2 A G 16: 35,697,988 S452P probably damaging Het
Elovl3 G A 19: 46,134,101 V113I probably benign Het
Fam53c A T 18: 34,762,618 probably benign Het
Fbxw15 A T 9: 109,555,684 F349L probably benign Het
Fuz C T 7: 44,896,277 P9L probably benign Het
Igf1r C T 7: 68,193,418 T759M possibly damaging Het
Impg2 G A 16: 56,221,517 D175N probably benign Het
Jade1 G T 3: 41,589,009 R43L possibly damaging Het
Kntc1 A G 5: 123,781,014 E816G probably damaging Het
Mettl8 A T 2: 70,973,297 D262E probably damaging Het
Mrpl48 A G 7: 100,552,583 V156A probably damaging Het
Mst1 A C 9: 108,082,215 K233N probably damaging Het
Myh13 A G 11: 67,334,564 I252V probably benign Het
Nox4 T C 7: 87,371,926 W449R probably damaging Het
Olfr167 A T 16: 19,515,378 L86* probably null Het
Olfr437 T C 6: 43,167,721 L221P probably damaging Het
Pappa2 A T 1: 158,782,403 probably null Het
Peg10 CCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATCC CCATCAGGATGCACATCAGGATCC 6: 4,756,442 probably benign Het
Polr3e T A 7: 120,922,961 I10K possibly damaging Het
Prkdc T C 16: 15,714,974 I1489T probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sh3pxd2b A G 11: 32,381,447 D57G probably damaging Het
Shank2 G A 7: 144,068,875 probably null Het
Slc15a4 A T 5: 127,616,969 V134E probably damaging Het
Stxbp5l G T 16: 37,186,654 Q726K probably benign Het
Tesk2 T G 4: 116,805,936 probably benign Het
Tex2 A G 11: 106,567,813 S264P probably benign Het
Tnik A G 3: 28,650,060 Q1003R probably damaging Het
Trip12 C T 1: 84,762,147 R628H probably damaging Het
Vmn2r69 G A 7: 85,411,783 H198Y probably benign Het
Other mutations in Pank4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00822:Pank4 APN 4 154980602 missense possibly damaging 0.50
IGL01105:Pank4 APN 4 154972465 splice site probably benign
IGL01291:Pank4 APN 4 154974646 missense probably damaging 0.98
IGL01935:Pank4 APN 4 154979530 missense probably damaging 1.00
IGL02366:Pank4 APN 4 154969628 missense probably benign 0.03
IGL02514:Pank4 APN 4 154970465 missense probably damaging 0.99
IGL03028:Pank4 APN 4 154969985 unclassified probably benign
IGL03033:Pank4 APN 4 154974715 missense probably damaging 1.00
ANU05:Pank4 UTSW 4 154974646 missense probably damaging 0.98
R0518:Pank4 UTSW 4 154976625 missense possibly damaging 0.90
R1196:Pank4 UTSW 4 154978173 missense probably damaging 0.99
R1566:Pank4 UTSW 4 154980521 missense probably damaging 0.98
R1581:Pank4 UTSW 4 154974651 missense probably damaging 1.00
R1709:Pank4 UTSW 4 154970047 missense probably damaging 1.00
R1852:Pank4 UTSW 4 154976359 missense probably damaging 1.00
R1950:Pank4 UTSW 4 154972520 missense probably benign
R2943:Pank4 UTSW 4 154971474 missense probably benign 0.01
R3911:Pank4 UTSW 4 154969601 missense probably damaging 1.00
R4162:Pank4 UTSW 4 154979594 critical splice donor site probably null
R4404:Pank4 UTSW 4 154980156 missense probably benign 0.00
R4619:Pank4 UTSW 4 154976619 missense probably benign 0.07
R4731:Pank4 UTSW 4 154971390 missense probably benign 0.01
R4732:Pank4 UTSW 4 154971390 missense probably benign 0.01
R4733:Pank4 UTSW 4 154971390 missense probably benign 0.01
R4747:Pank4 UTSW 4 154979532 missense probably damaging 1.00
R4760:Pank4 UTSW 4 154974634 missense possibly damaging 0.60
R5218:Pank4 UTSW 4 154979728 missense probably benign 0.01
R5774:Pank4 UTSW 4 154980662 missense probably damaging 1.00
R6004:Pank4 UTSW 4 154977221 missense probably damaging 1.00
R6376:Pank4 UTSW 4 154972236 splice site probably null
R7105:Pank4 UTSW 4 154980167 missense probably benign 0.07
R7253:Pank4 UTSW 4 154970920 missense probably benign 0.02
R7481:Pank4 UTSW 4 154970038 missense probably damaging 1.00
R7565:Pank4 UTSW 4 154980550 missense probably benign 0.08
R7718:Pank4 UTSW 4 154974643 missense probably damaging 1.00
R7736:Pank4 UTSW 4 154969747 missense probably benign 0.03
R8144:Pank4 UTSW 4 154970080 missense probably benign 0.01
Z1177:Pank4 UTSW 4 154974745 missense probably damaging 1.00
Z1177:Pank4 UTSW 4 154974784 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCCTGTCAGGTTCCACAGTG -3'
(R):5'- ATTGGTCTATTTACACGCTACGG -3'

Sequencing Primer
(F):5'- TCCACAGTGGACAGGCTAG -3'
(R):5'- GGTCTATTTACACGCTACGGATTAC -3'
Posted On2016-07-22