Incidental Mutation 'R5278:Olfr437'
ID404044
Institutional Source Beutler Lab
Gene Symbol Olfr437
Ensembl Gene ENSMUSG00000071481
Gene Nameolfactory receptor 437
SynonymsGA_x6K02T2P3E9-4391088-4390156, MOR261-11
MMRRC Submission 042865-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R5278 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location43163282-43169861 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43167721 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 221 (L221P)
Ref Sequence ENSEMBL: ENSMUSP00000145490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060243] [ENSMUST00000205175] [ENSMUST00000216179]
Predicted Effect probably damaging
Transcript: ENSMUST00000060243
AA Change: L221P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058147
Gene: ENSMUSG00000071481
AA Change: L221P

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 7.5e-60 PFAM
Pfam:7tm_1 40 289 3e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205175
AA Change: L221P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145490
Gene: ENSMUSG00000071481
AA Change: L221P

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 7.5e-60 PFAM
Pfam:7tm_1 40 289 3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216179
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 C T 5: 35,588,156 probably benign Het
Acvr2b G A 9: 119,432,489 V383I probably damaging Het
Akap12 T C 10: 4,354,792 M534T probably benign Het
Akp3 G A 1: 87,125,166 E26K probably benign Het
Alcam A G 16: 52,274,275 I371T probably benign Het
Ap2a1 T C 7: 44,902,779 T794A probably benign Het
Apeh G A 9: 108,091,258 P349S probably benign Het
Asb7 G T 7: 66,679,185 Q36K possibly damaging Het
Asl A G 5: 130,018,831 probably null Het
Atp13a2 T A 4: 141,000,818 I574N probably damaging Het
Bcl2l2 T A 14: 54,884,794 I138N probably damaging Het
Cacna1d C T 14: 30,352,924 probably null Het
Ccdc9 C T 7: 16,278,381 W1* probably null Het
Cdh18 T A 15: 23,474,158 S705T probably benign Het
Ces5a A T 8: 93,525,638 W209R probably damaging Het
Chpf2 T A 5: 24,588,090 probably benign Het
Cul9 T A 17: 46,510,873 H1892L probably damaging Het
Cxcl13 A G 5: 95,958,727 T53A probably benign Het
Cyp2s1 T A 7: 25,805,884 Y385F possibly damaging Het
Ddx46 A G 13: 55,676,038 E915G probably damaging Het
Dirc2 A G 16: 35,697,988 S452P probably damaging Het
Elovl3 G A 19: 46,134,101 V113I probably benign Het
Fam53c A T 18: 34,762,618 probably benign Het
Fbxw15 A T 9: 109,555,684 F349L probably benign Het
Fuz C T 7: 44,896,277 P9L probably benign Het
Igf1r C T 7: 68,193,418 T759M possibly damaging Het
Impg2 G A 16: 56,221,517 D175N probably benign Het
Jade1 G T 3: 41,589,009 R43L possibly damaging Het
Kntc1 A G 5: 123,781,014 E816G probably damaging Het
Mettl8 A T 2: 70,973,297 D262E probably damaging Het
Mrpl48 A G 7: 100,552,583 V156A probably damaging Het
Mst1 A C 9: 108,082,215 K233N probably damaging Het
Myh13 A G 11: 67,334,564 I252V probably benign Het
Nox4 T C 7: 87,371,926 W449R probably damaging Het
Olfr167 A T 16: 19,515,378 L86* probably null Het
Pank4 T C 4: 154,972,165 L351P probably damaging Het
Pappa2 A T 1: 158,782,403 probably null Het
Peg10 CCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATCC CCATCAGGATGCACATCAGGATCC 6: 4,756,442 probably benign Het
Polr3e T A 7: 120,922,961 I10K possibly damaging Het
Prkdc T C 16: 15,714,974 I1489T probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sh3pxd2b A G 11: 32,381,447 D57G probably damaging Het
Shank2 G A 7: 144,068,875 probably null Het
Slc15a4 A T 5: 127,616,969 V134E probably damaging Het
Stxbp5l G T 16: 37,186,654 Q726K probably benign Het
Tesk2 T G 4: 116,805,936 probably benign Het
Tex2 A G 11: 106,567,813 S264P probably benign Het
Tnik A G 3: 28,650,060 Q1003R probably damaging Het
Trip12 C T 1: 84,762,147 R628H probably damaging Het
Vmn2r69 G A 7: 85,411,783 H198Y probably benign Het
Other mutations in Olfr437
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Olfr437 APN 6 43167390 missense probably damaging 1.00
IGL01618:Olfr437 APN 6 43167703 missense probably damaging 0.97
IGL02426:Olfr437 APN 6 43167088 missense probably benign 0.02
R0548:Olfr437 UTSW 6 43167187 missense probably benign 0.43
R0856:Olfr437 UTSW 6 43167411 missense probably damaging 1.00
R1590:Olfr437 UTSW 6 43167912 missense probably damaging 1.00
R1902:Olfr437 UTSW 6 43167723 unclassified probably null
R3894:Olfr437 UTSW 6 43167258 missense probably benign 0.23
R5083:Olfr437 UTSW 6 43167339 missense probably benign 0.33
R6246:Olfr437 UTSW 6 43167502 unclassified probably null
R6781:Olfr437 UTSW 6 43167388 missense probably damaging 1.00
R6807:Olfr437 UTSW 6 43167238 missense probably damaging 1.00
R7253:Olfr437 UTSW 6 43167810 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAATTCTCCTGCTAAGGTTGC -3'
(R):5'- TTCACCTGGGTGTTCCTCAG -3'

Sequencing Primer
(F):5'- CCCTTTTGTGGGCCCCAG -3'
(R):5'- TCCTCAGACTATAGATGAGGGGATTC -3'
Posted On2016-07-22