Incidental Mutation 'R5278:Vmn2r69'
ID404052
Institutional Source Beutler Lab
Gene Symbol Vmn2r69
Ensembl Gene ENSMUSG00000091006
Gene Namevomeronasal 2, receptor 69
Synonyms
MMRRC Submission 042865-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R5278 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location85404849-85417476 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85411783 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 198 (H198Y)
Ref Sequence ENSEMBL: ENSMUSP00000132726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171213]
Predicted Effect probably benign
Transcript: ENSMUST00000171213
AA Change: H198Y

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000132726
Gene: ENSMUSG00000091006
AA Change: H198Y

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 465 1.3e-28 PFAM
Pfam:NCD3G 507 559 1.8e-20 PFAM
Pfam:7tm_3 592 827 3.2e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207880
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 C T 5: 35,588,156 probably benign Het
Acvr2b G A 9: 119,432,489 V383I probably damaging Het
Akap12 T C 10: 4,354,792 M534T probably benign Het
Akp3 G A 1: 87,125,166 E26K probably benign Het
Alcam A G 16: 52,274,275 I371T probably benign Het
Ap2a1 T C 7: 44,902,779 T794A probably benign Het
Apeh G A 9: 108,091,258 P349S probably benign Het
Asb7 G T 7: 66,679,185 Q36K possibly damaging Het
Asl A G 5: 130,018,831 probably null Het
Atp13a2 T A 4: 141,000,818 I574N probably damaging Het
Bcl2l2 T A 14: 54,884,794 I138N probably damaging Het
Cacna1d C T 14: 30,352,924 probably null Het
Ccdc9 C T 7: 16,278,381 W1* probably null Het
Cdh18 T A 15: 23,474,158 S705T probably benign Het
Ces5a A T 8: 93,525,638 W209R probably damaging Het
Chpf2 T A 5: 24,588,090 probably benign Het
Cul9 T A 17: 46,510,873 H1892L probably damaging Het
Cxcl13 A G 5: 95,958,727 T53A probably benign Het
Cyp2s1 T A 7: 25,805,884 Y385F possibly damaging Het
Ddx46 A G 13: 55,676,038 E915G probably damaging Het
Dirc2 A G 16: 35,697,988 S452P probably damaging Het
Elovl3 G A 19: 46,134,101 V113I probably benign Het
Fam53c A T 18: 34,762,618 probably benign Het
Fbxw15 A T 9: 109,555,684 F349L probably benign Het
Fuz C T 7: 44,896,277 P9L probably benign Het
Igf1r C T 7: 68,193,418 T759M possibly damaging Het
Impg2 G A 16: 56,221,517 D175N probably benign Het
Jade1 G T 3: 41,589,009 R43L possibly damaging Het
Kntc1 A G 5: 123,781,014 E816G probably damaging Het
Mettl8 A T 2: 70,973,297 D262E probably damaging Het
Mrpl48 A G 7: 100,552,583 V156A probably damaging Het
Mst1 A C 9: 108,082,215 K233N probably damaging Het
Myh13 A G 11: 67,334,564 I252V probably benign Het
Nox4 T C 7: 87,371,926 W449R probably damaging Het
Olfr167 A T 16: 19,515,378 L86* probably null Het
Olfr437 T C 6: 43,167,721 L221P probably damaging Het
Pank4 T C 4: 154,972,165 L351P probably damaging Het
Pappa2 A T 1: 158,782,403 probably null Het
Peg10 CCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATCC CCATCAGGATGCACATCAGGATCC 6: 4,756,442 probably benign Het
Polr3e T A 7: 120,922,961 I10K possibly damaging Het
Prkdc T C 16: 15,714,974 I1489T probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sh3pxd2b A G 11: 32,381,447 D57G probably damaging Het
Shank2 G A 7: 144,068,875 probably null Het
Slc15a4 A T 5: 127,616,969 V134E probably damaging Het
Stxbp5l G T 16: 37,186,654 Q726K probably benign Het
Tesk2 T G 4: 116,805,936 probably benign Het
Tex2 A G 11: 106,567,813 S264P probably benign Het
Tnik A G 3: 28,650,060 Q1003R probably damaging Het
Trip12 C T 1: 84,762,147 R628H probably damaging Het
Other mutations in Vmn2r69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Vmn2r69 APN 7 85406531 missense probably benign
IGL01457:Vmn2r69 APN 7 85406628 missense possibly damaging 0.87
IGL01760:Vmn2r69 APN 7 85406864 missense possibly damaging 0.90
IGL01834:Vmn2r69 APN 7 85412368 missense probably damaging 1.00
IGL02001:Vmn2r69 APN 7 85407226 missense probably benign 0.05
IGL02057:Vmn2r69 APN 7 85411782 missense possibly damaging 0.93
IGL02289:Vmn2r69 APN 7 85406846 missense probably damaging 1.00
IGL02472:Vmn2r69 APN 7 85409752 missense probably benign 0.01
IGL02478:Vmn2r69 APN 7 85406681 missense probably damaging 1.00
IGL02554:Vmn2r69 APN 7 85409806 missense probably damaging 1.00
IGL02723:Vmn2r69 APN 7 85410208 missense probably damaging 1.00
R0526:Vmn2r69 UTSW 7 85411503 missense probably damaging 1.00
R0560:Vmn2r69 UTSW 7 85409714 critical splice donor site probably null
R0909:Vmn2r69 UTSW 7 85406665 missense probably benign 0.00
R0976:Vmn2r69 UTSW 7 85406900 missense probably damaging 1.00
R1158:Vmn2r69 UTSW 7 85409850 splice site probably benign
R1459:Vmn2r69 UTSW 7 85406700 nonsense probably null
R1482:Vmn2r69 UTSW 7 85406874 missense probably damaging 1.00
R1917:Vmn2r69 UTSW 7 85411683 missense probably damaging 1.00
R2016:Vmn2r69 UTSW 7 85407285 missense probably damaging 0.98
R2108:Vmn2r69 UTSW 7 85410196 missense probably benign
R2571:Vmn2r69 UTSW 7 85415556 missense probably benign
R2910:Vmn2r69 UTSW 7 85406710 missense probably damaging 1.00
R2920:Vmn2r69 UTSW 7 85411765 missense probably benign 0.08
R3708:Vmn2r69 UTSW 7 85411821 missense probably damaging 0.98
R3710:Vmn2r69 UTSW 7 85406393 missense probably benign
R4757:Vmn2r69 UTSW 7 85412367 missense probably damaging 0.99
R4823:Vmn2r69 UTSW 7 85411300 missense probably benign 0.21
R4870:Vmn2r69 UTSW 7 85411585 missense possibly damaging 0.93
R4918:Vmn2r69 UTSW 7 85406759 missense probably benign 0.06
R5022:Vmn2r69 UTSW 7 85411159 missense possibly damaging 0.72
R5174:Vmn2r69 UTSW 7 85415531 missense possibly damaging 0.92
R5200:Vmn2r69 UTSW 7 85406509 missense probably damaging 1.00
R5643:Vmn2r69 UTSW 7 85407196 missense probably damaging 0.98
R5996:Vmn2r69 UTSW 7 85411909 splice site probably null
R6083:Vmn2r69 UTSW 7 85406503 missense probably damaging 1.00
R6140:Vmn2r69 UTSW 7 85411449 missense probably damaging 0.99
R6306:Vmn2r69 UTSW 7 85415591 missense probably benign 0.04
R6330:Vmn2r69 UTSW 7 85411627 missense probably benign
R6380:Vmn2r69 UTSW 7 85411859 missense probably benign
R6466:Vmn2r69 UTSW 7 85407170 missense probably benign 0.01
R6542:Vmn2r69 UTSW 7 85411205 nonsense probably null
R6583:Vmn2r69 UTSW 7 85409809 missense probably benign
R6623:Vmn2r69 UTSW 7 85407101 missense possibly damaging 0.84
R6709:Vmn2r69 UTSW 7 85411861 missense probably benign 0.03
R6732:Vmn2r69 UTSW 7 85411143 missense probably benign 0.00
R6741:Vmn2r69 UTSW 7 85412516 missense probably benign 0.01
R7070:Vmn2r69 UTSW 7 85411480 missense probably damaging 0.98
R7234:Vmn2r69 UTSW 7 85407107 missense probably benign 0.22
R7323:Vmn2r69 UTSW 7 85411764 missense possibly damaging 0.95
R7427:Vmn2r69 UTSW 7 85411259 missense probably benign 0.28
R7428:Vmn2r69 UTSW 7 85411259 missense probably benign 0.28
R7453:Vmn2r69 UTSW 7 85411560 frame shift probably null
R7532:Vmn2r69 UTSW 7 85410414 missense probably benign 0.36
R7556:Vmn2r69 UTSW 7 85411560 frame shift probably null
R7562:Vmn2r69 UTSW 7 85407212 missense probably benign
R7592:Vmn2r69 UTSW 7 85411560 frame shift probably null
R7708:Vmn2r69 UTSW 7 85412547 missense possibly damaging 0.87
R7803:Vmn2r69 UTSW 7 85407116 missense probably benign 0.00
Z1176:Vmn2r69 UTSW 7 85406488 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACAATGTGAGGGCATAAT -3'
(R):5'- GCTCAAGCACACTCCGATCT -3'

Sequencing Primer
(F):5'- CCACAATGTGAGGGCATAATTTATGG -3'
(R):5'- GATCTCACAACAACCCCTCTG -3'
Posted On2016-07-22