Mutagenetix > Incidental Mutations

Incidental Mutation 'R5278:Sh3pxd2b'

404063

Institutional Source

Beutler Lab

Gene Symbol

Sh3pxd2b

Ensembl Gene

ENSMUSG00000040711

Gene Name

SH3 and PX domains 2B

Synonyms

G431001E03Rik, Fad49, Tsk4

MMRRC Submission

042865-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.275) question?

Stock #

R5278 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32347820-32428173 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 32381447 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 57 (D57G)

Ref Sequence

ENSEMBL: ENSMUSP00000044276 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038753]

Predicted Effect

probably damaging
Transcript: ENSMUST00000038753
AA Change: D57G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000044276
Gene: ENSMUSG00000040711
AA Change: D57G

Domain	Start	End	E-Value	Type
PX	5	125	2.65e-30	SMART
SH3	155	210	1.11e-14	SMART
SH3	224	279	3.78e-17	SMART
SH3	371	426	2.33e-8	SMART
low complexity region	525	540	N/A	INTRINSIC
low complexity region	748	772	N/A	INTRINSIC
SH3	850	908	5.75e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138771

Meta Mutation Damage Score

0.3788

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.9%
20x: 96.6%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adapter protein that is characterized by a PX domain and four Src homology 3 domains. The encoded protein is required for podosome formation and is involved in cell adhesion and migration of numerous cell types. Mutations in this gene are the cause of Frank-ter Haar syndrome (FTHS), and also Borrone Dermato-Cardio-Skeletal (BDCS) syndrome. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit abnormal craniofacial morphology, decreased bone density, impaired hearing secondary to otis media, reduced growth, size, and weight, and decreased white adipose tissue. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox3	C	T	5: 35,588,156		probably benign	Het
Acvr2b	G	A	9: 119,432,489	V383I	probably damaging	Het
Akap12	T	C	10: 4,354,792	M534T	probably benign	Het
Akp3	G	A	1: 87,125,166	E26K	probably benign	Het
Alcam	A	G	16: 52,274,275	I371T	probably benign	Het
Ap2a1	T	C	7: 44,902,779	T794A	probably benign	Het
Apeh	G	A	9: 108,091,258	P349S	probably benign	Het
Asb7	G	T	7: 66,679,185	Q36K	possibly damaging	Het
Asl	A	G	5: 130,018,831		probably null	Het
Atp13a2	T	A	4: 141,000,818	I574N	probably damaging	Het
Bcl2l2	T	A	14: 54,884,794	I138N	probably damaging	Het
Cacna1d	C	T	14: 30,352,924		probably null	Het
Ccdc9	C	T	7: 16,278,381	W1*	probably null	Het
Cdh18	T	A	15: 23,474,158	S705T	probably benign	Het
Ces5a	A	T	8: 93,525,638	W209R	probably damaging	Het
Chpf2	T	A	5: 24,588,090		probably benign	Het
Cul9	T	A	17: 46,510,873	H1892L	probably damaging	Het
Cxcl13	A	G	5: 95,958,727	T53A	probably benign	Het
Cyp2s1	T	A	7: 25,805,884	Y385F	possibly damaging	Het
Ddx46	A	G	13: 55,676,038	E915G	probably damaging	Het
Dirc2	A	G	16: 35,697,988	S452P	probably damaging	Het
Elovl3	G	A	19: 46,134,101	V113I	probably benign	Het
Fam53c	A	T	18: 34,762,618		probably benign	Het
Fbxw15	A	T	9: 109,555,684	F349L	probably benign	Het
Fuz	C	T	7: 44,896,277	P9L	probably benign	Het
Igf1r	C	T	7: 68,193,418	T759M	possibly damaging	Het
Impg2	G	A	16: 56,221,517	D175N	probably benign	Het
Jade1	G	T	3: 41,589,009	R43L	possibly damaging	Het
Kntc1	A	G	5: 123,781,014	E816G	probably damaging	Het
Mettl8	A	T	2: 70,973,297	D262E	probably damaging	Het
Mrpl48	A	G	7: 100,552,583	V156A	probably damaging	Het
Mst1	A	C	9: 108,082,215	K233N	probably damaging	Het
Myh13	A	G	11: 67,334,564	I252V	probably benign	Het
Nox4	T	C	7: 87,371,926	W449R	probably damaging	Het
Olfr167	A	T	16: 19,515,378	L86*	probably null	Het
Olfr437	T	C	6: 43,167,721	L221P	probably damaging	Het
Pank4	T	C	4: 154,972,165	L351P	probably damaging	Het
Pappa2	A	T	1: 158,782,403		probably null	Het
Peg10	CCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATCC	CCATCAGGATGCACATCAGGATCC	6: 4,756,442		probably benign	Het
Polr3e	T	A	7: 120,922,961	I10K	possibly damaging	Het
Prkdc	T	C	16: 15,714,974	I1489T	probably damaging	Het
Robo4	CGG	CG	9: 37,411,490		probably null	Het
Shank2	G	A	7: 144,068,875		probably null	Het
Slc15a4	A	T	5: 127,616,969	V134E	probably damaging	Het
Stxbp5l	G	T	16: 37,186,654	Q726K	probably benign	Het
Tesk2	T	G	4: 116,805,936		probably benign	Het
Tex2	A	G	11: 106,567,813	S264P	probably benign	Het
Tnik	A	G	3: 28,650,060	Q1003R	probably damaging	Het
Trip12	C	T	1: 84,762,147	R628H	probably damaging	Het
Vmn2r69	G	A	7: 85,411,783	H198Y	probably benign	Het

Other mutations in Sh3pxd2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01017:Sh3pxd2b	APN	11	32403993	nonsense	probably null
IGL01581:Sh3pxd2b	APN	11	32387973	missense	possibly damaging	0.64
IGL02067:Sh3pxd2b	APN	11	32423095	missense	probably benign	0.01
IGL02412:Sh3pxd2b	APN	11	32387992	missense	probably damaging	0.99
IGL02930:Sh3pxd2b	APN	11	32417161	missense	possibly damaging	0.91
IGL03299:Sh3pxd2b	APN	11	32411448	splice site	probably benign
IGL03378:Sh3pxd2b	APN	11	32381443	missense	probably damaging	1.00
FR4449:Sh3pxd2b	UTSW	11	32423065	small insertion	probably benign
FR4548:Sh3pxd2b	UTSW	11	32423064	small insertion	probably benign
FR4548:Sh3pxd2b	UTSW	11	32423065	small insertion	probably benign
FR4976:Sh3pxd2b	UTSW	11	32423055	small insertion	probably benign
FR4976:Sh3pxd2b	UTSW	11	32423060	small insertion	probably benign
R0097:Sh3pxd2b	UTSW	11	32403978	missense	probably damaging	1.00
R0097:Sh3pxd2b	UTSW	11	32403978	missense	probably damaging	1.00
R0441:Sh3pxd2b	UTSW	11	32423023	missense	possibly damaging	0.77
R0715:Sh3pxd2b	UTSW	11	32423341	missense	possibly damaging	0.93
R1456:Sh3pxd2b	UTSW	11	32415967	missense	probably damaging	1.00
R1616:Sh3pxd2b	UTSW	11	32381441	missense	possibly damaging	0.90
R1748:Sh3pxd2b	UTSW	11	32422203	missense	possibly damaging	0.92
R1902:Sh3pxd2b	UTSW	11	32423559	makesense	probably null
R1977:Sh3pxd2b	UTSW	11	32422138	missense	probably damaging	1.00
R3761:Sh3pxd2b	UTSW	11	32422750	missense	probably benign	0.45
R3850:Sh3pxd2b	UTSW	11	32411505	missense	probably damaging	1.00
R4060:Sh3pxd2b	UTSW	11	32422263	missense	probably benign	0.16
R4062:Sh3pxd2b	UTSW	11	32422263	missense	probably benign	0.16
R4064:Sh3pxd2b	UTSW	11	32422263	missense	probably benign	0.16
R4585:Sh3pxd2b	UTSW	11	32396479	missense	possibly damaging	0.84
R5652:Sh3pxd2b	UTSW	11	32422812	missense	probably damaging	1.00
R5827:Sh3pxd2b	UTSW	11	32422422	missense	probably benign	0.01
R5994:Sh3pxd2b	UTSW	11	32407570	missense	probably damaging	1.00
R6083:Sh3pxd2b	UTSW	11	32422985	missense	probably benign	0.30
R6392:Sh3pxd2b	UTSW	11	32423302	missense	possibly damaging	0.74
R6625:Sh3pxd2b	UTSW	11	32422594	missense	possibly damaging	0.74
R6649:Sh3pxd2b	UTSW	11	32415978	splice site	probably null
R7056:Sh3pxd2b	UTSW	11	32422737	missense	probably benign	0.01
R7131:Sh3pxd2b	UTSW	11	32422072	missense	probably damaging	1.00
R7192:Sh3pxd2b	UTSW	11	32414318	missense	probably damaging	1.00
R7911:Sh3pxd2b	UTSW	11	32371533	missense	probably damaging	1.00
R8026:Sh3pxd2b	UTSW	11	32411567	missense	probably damaging	1.00
R8027:Sh3pxd2b	UTSW	11	32422210	missense	probably benign	0.01
R8555:Sh3pxd2b	UTSW	11	32411469	missense	probably benign	0.34
RF016:Sh3pxd2b	UTSW	11	32423053	small insertion	probably benign
RF022:Sh3pxd2b	UTSW	11	32423054	small insertion	probably benign
RF025:Sh3pxd2b	UTSW	11	32423057	small insertion	probably benign
RF040:Sh3pxd2b	UTSW	11	32423055	small insertion	probably benign
RF056:Sh3pxd2b	UTSW	11	32423055	small insertion	probably benign
RF063:Sh3pxd2b	UTSW	11	32423051	small insertion	probably benign
X0017:Sh3pxd2b	UTSW	11	32414359	missense	possibly damaging	0.94
X0028:Sh3pxd2b	UTSW	11	32423110	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCCACGTAAGCTCTCAGATC -3'
(R):5'- CAGCATTCTCTCACAAGGAGG -3'

Sequencing Primer
(F):5'- GTAAGCTCTCAGATCCAGACTCCATG -3'
(R):5'- TTTCCCTACGTTAGTGACAGAG -3'

Posted On

2016-07-22