Mutagenetix > Incidental Mutations

Incidental Mutation 'R5278:Stxbp5l'

404073

Institutional Source

Beutler Lab

Gene Symbol

Stxbp5l

Ensembl Gene

ENSMUSG00000022829

Gene Name

syntaxin binding protein 5-like

Synonyms

t2md1, insulin level locus 1, tomosyn-2, T2dm1, A830015P08Rik, LLGL4

MMRRC Submission

042865-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5278 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

37114942-37384962 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 37186654 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 726 (Q726K)

Ref Sequence

ENSEMBL: ENSMUSP00000110435 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023526] [ENSMUST00000114780] [ENSMUST00000114781] [ENSMUST00000114782] [ENSMUST00000114787]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000023526

SMART Domains

Protein: ENSMUSP00000023526
Gene: ENSMUSG00000022829

Domain	Start	End	E-Value	Type
low complexity region	16	40	N/A	INTRINSIC
WD40	58	97	1.1e2	SMART
WD40	99	138	6.66e-1	SMART
Blast:WD40	143	182	2e-20	BLAST
WD40	197	236	2.22e0	SMART
WD40	240	277	1.7e-2	SMART
Pfam:LLGL	284	396	7.6e-45	PFAM
WD40	397	476	7.7e-1	SMART
WD40	501	541	6.14e1	SMART
low complexity region	577	592	N/A	INTRINSIC
low complexity region	790	804	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114780

SMART Domains

Protein: ENSMUSP00000110428
Gene: ENSMUSG00000022829

Domain	Start	End	E-Value	Type
low complexity region	16	40	N/A	INTRINSIC
WD40	58	97	1.1e2	SMART
WD40	99	138	6.66e-1	SMART
Blast:WD40	143	182	1e-20	BLAST
WD40	197	236	2.22e0	SMART
WD40	240	277	1.7e-2	SMART
Pfam:LLGL	284	396	8.6e-45	PFAM
WD40	397	476	7.7e-1	SMART
WD40	501	541	6.14e1	SMART
low complexity region	577	592	N/A	INTRINSIC
Pfam:Lgl_C	731	988	3e-9	PFAM
PDB:1URQ\|A	1038	1097	2e-25	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000114781
AA Change: Q726K

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000110429
Gene: ENSMUSG00000022829
AA Change: Q726K

Domain	Start	End	E-Value	Type
low complexity region	16	40	N/A	INTRINSIC
WD40	58	97	1.1e2	SMART
WD40	99	138	6.66e-1	SMART
Blast:WD40	143	182	1e-20	BLAST
WD40	197	236	2.22e0	SMART
WD40	240	277	1.7e-2	SMART
Pfam:LLGL	284	396	8.9e-45	PFAM
WD40	397	476	7.7e-1	SMART
WD40	501	541	6.14e1	SMART
low complexity region	577	592	N/A	INTRINSIC
Pfam:Lgl_C	755	1012	3.1e-9	PFAM
PDB:1URQ\|A	1062	1121	2e-25	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000114782

SMART Domains

Protein: ENSMUSP00000110430
Gene: ENSMUSG00000022829

Domain	Start	End	E-Value	Type
low complexity region	16	40	N/A	INTRINSIC
WD40	58	97	1.1e2	SMART
WD40	99	138	6.66e-1	SMART
Blast:WD40	143	182	1e-20	BLAST
WD40	197	236	2.22e0	SMART
WD40	240	277	1.7e-2	SMART
Pfam:LLGL	284	396	9.2e-45	PFAM
WD40	397	476	7.7e-1	SMART
WD40	501	541	6.14e1	SMART
low complexity region	577	592	N/A	INTRINSIC
Pfam:Lgl_C	785	1045	3.1e-9	PFAM
PDB:1URQ\|A	1095	1154	2e-25	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000114787
AA Change: Q726K

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000110435
Gene: ENSMUSG00000022829
AA Change: Q726K

Domain	Start	End	E-Value	Type
low complexity region	16	40	N/A	INTRINSIC
WD40	58	97	1.1e2	SMART
WD40	99	138	6.66e-1	SMART
Blast:WD40	143	182	1e-20	BLAST
WD40	197	236	2.22e0	SMART
WD40	240	277	1.7e-2	SMART
Pfam:LLGL	287	396	8.7e-35	PFAM
WD40	397	476	7.7e-1	SMART
WD40	501	541	6.14e1	SMART
low complexity region	577	592	N/A	INTRINSIC
Pfam:Lgl_C	811	1069	3.3e-9	PFAM
PDB:1URQ\|A	1119	1178	2e-25	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149984

Meta Mutation Damage Score

0.0980

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.9%
20x: 96.6%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to syntaxin-binding protein 5 and contains ten N-terminal WD40 repeats, four variable region WD40 repeats, and a C-terminal R-SNARE domain. Studies of the orthologous proteins in mouse and rat have shown that the encoded protein may inhibit exocytosis in neurosecretory cells, and may negatively regulate the secretion of insulin. A missense variant in this gene is likely the cause of an infantile-onset neurodegenerative disorder diagnosed in two siblings of consanguineous parents. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a QTL derived from BTBR exhibit increased fasting serum glucose and decreased fasting serum insulin. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox3	C	T	5: 35,588,156		probably benign	Het
Acvr2b	G	A	9: 119,432,489	V383I	probably damaging	Het
Akap12	T	C	10: 4,354,792	M534T	probably benign	Het
Akp3	G	A	1: 87,125,166	E26K	probably benign	Het
Alcam	A	G	16: 52,274,275	I371T	probably benign	Het
Ap2a1	T	C	7: 44,902,779	T794A	probably benign	Het
Apeh	G	A	9: 108,091,258	P349S	probably benign	Het
Asb7	G	T	7: 66,679,185	Q36K	possibly damaging	Het
Asl	A	G	5: 130,018,831		probably null	Het
Atp13a2	T	A	4: 141,000,818	I574N	probably damaging	Het
Bcl2l2	T	A	14: 54,884,794	I138N	probably damaging	Het
Cacna1d	C	T	14: 30,352,924		probably null	Het
Ccdc9	C	T	7: 16,278,381	W1*	probably null	Het
Cdh18	T	A	15: 23,474,158	S705T	probably benign	Het
Ces5a	A	T	8: 93,525,638	W209R	probably damaging	Het
Chpf2	T	A	5: 24,588,090		probably benign	Het
Cul9	T	A	17: 46,510,873	H1892L	probably damaging	Het
Cxcl13	A	G	5: 95,958,727	T53A	probably benign	Het
Cyp2s1	T	A	7: 25,805,884	Y385F	possibly damaging	Het
Ddx46	A	G	13: 55,676,038	E915G	probably damaging	Het
Dirc2	A	G	16: 35,697,988	S452P	probably damaging	Het
Elovl3	G	A	19: 46,134,101	V113I	probably benign	Het
Fam53c	A	T	18: 34,762,618		probably benign	Het
Fbxw15	A	T	9: 109,555,684	F349L	probably benign	Het
Fuz	C	T	7: 44,896,277	P9L	probably benign	Het
Igf1r	C	T	7: 68,193,418	T759M	possibly damaging	Het
Impg2	G	A	16: 56,221,517	D175N	probably benign	Het
Jade1	G	T	3: 41,589,009	R43L	possibly damaging	Het
Kntc1	A	G	5: 123,781,014	E816G	probably damaging	Het
Mettl8	A	T	2: 70,973,297	D262E	probably damaging	Het
Mrpl48	A	G	7: 100,552,583	V156A	probably damaging	Het
Mst1	A	C	9: 108,082,215	K233N	probably damaging	Het
Myh13	A	G	11: 67,334,564	I252V	probably benign	Het
Nox4	T	C	7: 87,371,926	W449R	probably damaging	Het
Olfr167	A	T	16: 19,515,378	L86*	probably null	Het
Olfr437	T	C	6: 43,167,721	L221P	probably damaging	Het
Pank4	T	C	4: 154,972,165	L351P	probably damaging	Het
Pappa2	A	T	1: 158,782,403		probably null	Het
Peg10	CCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATCC	CCATCAGGATGCACATCAGGATCC	6: 4,756,442		probably benign	Het
Polr3e	T	A	7: 120,922,961	I10K	possibly damaging	Het
Prkdc	T	C	16: 15,714,974	I1489T	probably damaging	Het
Robo4	CGG	CG	9: 37,411,490		probably null	Het
Sh3pxd2b	A	G	11: 32,381,447	D57G	probably damaging	Het
Shank2	G	A	7: 144,068,875		probably null	Het
Slc15a4	A	T	5: 127,616,969	V134E	probably damaging	Het
Tesk2	T	G	4: 116,805,936		probably benign	Het
Tex2	A	G	11: 106,567,813	S264P	probably benign	Het
Tnik	A	G	3: 28,650,060	Q1003R	probably damaging	Het
Trip12	C	T	1: 84,762,147	R628H	probably damaging	Het
Vmn2r69	G	A	7: 85,411,783	H198Y	probably benign	Het

Other mutations in Stxbp5l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00836:Stxbp5l	APN	16	37208100	missense	possibly damaging	0.82
IGL01082:Stxbp5l	APN	16	37204578	missense	possibly damaging	0.89
IGL01448:Stxbp5l	APN	16	37215979	missense	probably damaging	0.99
IGL01475:Stxbp5l	APN	16	37345092	missense	possibly damaging	0.95
IGL01899:Stxbp5l	APN	16	37200592	missense	probably benign	0.19
IGL02232:Stxbp5l	APN	16	37329895	missense	probably damaging	1.00
IGL02389:Stxbp5l	APN	16	37208205	missense	probably benign	0.00
IGL02745:Stxbp5l	APN	16	37186654	nonsense	probably null
IGL03125:Stxbp5l	APN	16	37186721	missense	probably benign	0.02
R0058:Stxbp5l	UTSW	16	37142374	missense	possibly damaging	0.76
R0345:Stxbp5l	UTSW	16	37288308	missense	probably damaging	1.00
R0359:Stxbp5l	UTSW	16	37216078	splice site	probably benign
R0454:Stxbp5l	UTSW	16	37134284	missense	possibly damaging	0.94
R0525:Stxbp5l	UTSW	16	37129797	critical splice donor site	probably null
R0543:Stxbp5l	UTSW	16	37208096	missense	probably damaging	1.00
R0606:Stxbp5l	UTSW	16	37204521	missense	possibly damaging	0.46
R0607:Stxbp5l	UTSW	16	37142432	missense	probably benign	0.00
R1333:Stxbp5l	UTSW	16	37247869	critical splice donor site	probably null
R1593:Stxbp5l	UTSW	16	37116052	missense	probably damaging	0.96
R1605:Stxbp5l	UTSW	16	37208111	missense	probably benign	0.34
R1670:Stxbp5l	UTSW	16	37290927	critical splice donor site	probably null
R2077:Stxbp5l	UTSW	16	37236275	missense	possibly damaging	0.93
R2209:Stxbp5l	UTSW	16	37216036	missense	probably damaging	0.98
R2504:Stxbp5l	UTSW	16	37115667	missense	probably damaging	1.00
R2909:Stxbp5l	UTSW	16	37208186	missense	possibly damaging	0.89
R2917:Stxbp5l	UTSW	16	37200642	nonsense	probably null
R2918:Stxbp5l	UTSW	16	37200642	nonsense	probably null
R2935:Stxbp5l	UTSW	16	37134189	missense	possibly damaging	0.76
R3693:Stxbp5l	UTSW	16	37241346	nonsense	probably null
R3694:Stxbp5l	UTSW	16	37241346	nonsense	probably null
R3695:Stxbp5l	UTSW	16	37241346	nonsense	probably null
R4133:Stxbp5l	UTSW	16	37208119	missense	possibly damaging	0.80
R4180:Stxbp5l	UTSW	16	37247880	missense	probably benign	0.05
R4676:Stxbp5l	UTSW	16	37255884	missense	probably damaging	1.00
R4757:Stxbp5l	UTSW	16	37188634	missense	probably damaging	1.00
R4758:Stxbp5l	UTSW	16	37134230	missense	probably benign	0.18
R5105:Stxbp5l	UTSW	16	37142372	missense	probably benign	0.43
R5358:Stxbp5l	UTSW	16	37174326	missense	probably damaging	0.99
R5411:Stxbp5l	UTSW	16	37129851	missense	probably damaging	1.00
R5773:Stxbp5l	UTSW	16	37208097	missense	probably damaging	1.00
R6539:Stxbp5l	UTSW	16	37129815	missense	probably damaging	1.00
R6869:Stxbp5l	UTSW	16	37204448	missense	possibly damaging	0.74
R6892:Stxbp5l	UTSW	16	37188629	missense	possibly damaging	0.94
R7369:Stxbp5l	UTSW	16	37134341	missense	probably benign	0.12
R7555:Stxbp5l	UTSW	16	37323603	missense	probably damaging	1.00
R7657:Stxbp5l	UTSW	16	37210172	missense	probably null	0.21
R8171:Stxbp5l	UTSW	16	37208054	missense	noncoding transcript
R8338:Stxbp5l	UTSW	16	37174356	missense	probably damaging	1.00
Z1088:Stxbp5l	UTSW	16	37204489	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGCTGGTGGATAGACACATGAC -3'
(R):5'- ACCTTGGCTGTTCTAGATTCTG -3'

Sequencing Primer
(F):5'- TGGTGGATAGACACATGACAACAATG -3'
(R):5'- GGCTGTTCTAGATTCTGGTATGATAC -3'

Posted On

2016-07-22