Incidental Mutation 'R5279:Pdia3'
ID404088
Institutional Source Beutler Lab
Gene Symbol Pdia3
Ensembl Gene ENSMUSG00000027248
Gene Nameprotein disulfide isomerase associated 3
SynonymsERp61, Plca, PDI, Grp58, Erp, PDI-Q2, ERp57, ERp60
MMRRC Submission 042839-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5279 (G1)
Quality Score146
Status Validated
Chromosome2
Chromosomal Location121413775-121438687 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 121414003 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028683] [ENSMUST00000038073] [ENSMUST00000135079] [ENSMUST00000154604]
Predicted Effect probably benign
Transcript: ENSMUST00000028683
SMART Domains Protein: ENSMUSP00000028683
Gene: ENSMUSG00000027248

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Thioredoxin 26 131 5.2e-36 PFAM
Pfam:Thioredoxin_6 160 355 2e-29 PFAM
Pfam:Thioredoxin 377 483 9.5e-33 PFAM
low complexity region 487 503 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038073
SMART Domains Protein: ENSMUSP00000037222
Gene: ENSMUSG00000033486

DomainStartEndE-ValueType
low complexity region 78 91 N/A INTRINSIC
Pfam:Ion_trans 105 350 1e-35 PFAM
low complexity region 422 447 N/A INTRINSIC
internal_repeat_1 450 473 3.72e-11 PROSPERO
internal_repeat_1 465 488 3.72e-11 PROSPERO
low complexity region 491 502 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123982
Predicted Effect probably benign
Transcript: ENSMUST00000135079
SMART Domains Protein: ENSMUSP00000119337
Gene: ENSMUSG00000027248

DomainStartEndE-ValueType
Pfam:Thioredoxin 3 105 5.1e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153378
Predicted Effect probably benign
Transcript: ENSMUST00000154604
SMART Domains Protein: ENSMUSP00000119091
Gene: ENSMUSG00000033486

DomainStartEndE-ValueType
low complexity region 78 91 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein of the endoplasmic reticulum that interacts with lectin chaperones calreticulin and calnexin to modulate folding of newly synthesized glycoproteins. The protein was once thought to be a phospholipase; however, it has been demonstrated that the protein actually has protein disulfide isomerase activity. It is thought that complexes of lectins and this protein mediate protein folding by promoting formation of disulfide bonds in their glycoprotein substrates. This protein also functions as a molecular chaperone that prevents the formation of protein aggregates. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele die by E13.5 with minor changes in ER calcium capacity and unfolded protein response in mouse embryonic fibroblasts. Mice homozygous for a gene trap allele die prior to birth while heterozygous mice exhibit abnormalbone volume bone morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 C A 17: 24,289,414 G1049V probably damaging Het
Afdn G A 17: 13,888,952 R1579H probably damaging Het
Ankrd28 T A 14: 31,735,006 N386Y probably damaging Het
Atf7ip T A 6: 136,603,379 Y1100* probably null Het
Atp9b T A 18: 80,912,858 E3V probably damaging Het
AW554918 T G 18: 25,175,431 D60E possibly damaging Het
Baz2b G T 2: 59,932,152 Q927K probably damaging Het
Birc6 A G 17: 74,650,047 R3659G probably damaging Het
C8a T G 4: 104,845,988 N291H probably damaging Het
Calcoco1 G A 15: 102,710,985 L390F probably damaging Het
Carmil3 A G 14: 55,501,571 D894G probably damaging Het
Cdc20 A G 4: 118,433,514 Y430H probably damaging Het
Cdc6 A T 11: 98,912,262 I316F probably damaging Het
Cenpu T A 8: 46,578,910 probably null Het
Csmd2 T A 4: 128,456,914 V1592D probably benign Het
Csmd3 G T 15: 48,791,944 probably null Het
Dnah7c T C 1: 46,519,269 F512L probably benign Het
Fam136a T A 6: 86,366,704 L61Q probably damaging Het
Fpgs A C 2: 32,692,767 probably benign Het
Fzd4 G A 7: 89,407,673 M309I probably benign Het
Gad2 A G 2: 22,673,957 T391A probably benign Het
Gm11563 A T 11: 99,658,713 S72T unknown Het
Gm5155 T A 7: 17,873,289 noncoding transcript Het
Gon4l A G 3: 88,887,637 I716V probably benign Het
Itga9 T C 9: 118,628,205 V128A probably damaging Het
Kat6a CGCAGCAGCAGCAGCAGCA CGCAGCAGCAGCA 8: 22,939,648 probably benign Het
Lrrc9 T A 12: 72,495,594 D1063E possibly damaging Het
Lyst T A 13: 13,648,802 L1453* probably null Het
Mcm3ap T C 10: 76,507,539 V1755A probably damaging Het
Mrc1 T C 2: 14,310,058 S985P probably damaging Het
Mst1 A C 9: 108,082,215 K233N probably damaging Het
Nr2c2ap G A 8: 70,132,003 D42N probably damaging Het
Ntn1 A G 11: 68,385,712 S137P probably benign Het
Pard3 T C 8: 127,460,386 probably null Het
Pcdh15 T A 10: 74,594,183 D1210E probably damaging Het
Pcdhga5 T C 18: 37,694,721 L74P probably benign Het
Pcsk5 T C 19: 17,595,658 probably null Het
Pikfyve A T 1: 65,196,699 R177* probably null Het
Pklr A G 3: 89,143,259 E409G probably damaging Het
Plod2 T C 9: 92,581,323 Y154H probably damaging Het
Psmc3 T A 2: 91,054,322 D6E probably benign Het
Ptpru T A 4: 131,820,023 N205I possibly damaging Het
Rbm6 T C 9: 107,778,014 E1006G probably benign Het
Rgl2 T C 17: 33,935,948 V642A probably benign Het
Rnf8 T A 17: 29,626,706 H104Q possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Rpa1 T C 11: 75,313,344 N269S probably damaging Het
Sdk2 A G 11: 113,867,031 M519T probably benign Het
Snx30 A G 4: 59,885,070 S237G probably benign Het
Spx A G 6: 142,414,040 N36S probably damaging Het
Stard7 T C 2: 127,295,496 Y289H probably damaging Het
Sugp2 T C 8: 70,257,107 probably benign Het
Susd4 C T 1: 182,887,478 T288I probably damaging Het
Tceanc2 T A 4: 107,177,629 probably null Het
Tm4sf4 T G 3: 57,433,738 V97G probably benign Het
Tmtc1 C T 6: 148,355,131 probably benign Het
Trappc11 C T 8: 47,505,304 probably benign Het
Triobp G T 15: 78,994,391 V398F possibly damaging Het
Ttll9 T A 2: 152,962,544 S2T possibly damaging Het
Ttn T C 2: 76,900,976 probably benign Het
Tyw3 A G 3: 154,594,471 C80R probably damaging Het
Usp24 T C 4: 106,385,424 V1177A possibly damaging Het
Vmn1r65 A G 7: 6,008,755 V160A probably damaging Het
Vmn2r104 T A 17: 20,041,884 H328L probably benign Het
Vmn2r65 A C 7: 84,940,641 I689S probably damaging Het
Wrn A G 8: 33,241,101 Y1068H probably damaging Het
Xpo4 C A 14: 57,613,409 S346I probably benign Het
Zc3h3 T A 15: 75,839,590 T341S probably benign Het
Zxdc T C 6: 90,370,437 M260T possibly damaging Het
Other mutations in Pdia3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Pdia3 APN 2 121414178 missense probably damaging 1.00
IGL00777:Pdia3 APN 2 121429556 missense probably damaging 1.00
IGL02020:Pdia3 APN 2 121436419 splice site probably null
IGL02437:Pdia3 APN 2 121433648 missense probably damaging 1.00
IGL02988:Pdia3 UTSW 2 121429556 missense probably damaging 1.00
PIT4812001:Pdia3 UTSW 2 121433530 missense probably damaging 1.00
R0242:Pdia3 UTSW 2 121414111 missense probably damaging 1.00
R0242:Pdia3 UTSW 2 121414111 missense probably damaging 1.00
R0606:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R0612:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R0658:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R0724:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R0730:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R0880:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R0882:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R1157:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R1160:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R1238:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R1619:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R1853:Pdia3 UTSW 2 121431663 missense probably benign 0.20
R1854:Pdia3 UTSW 2 121431663 missense probably benign 0.20
R2014:Pdia3 UTSW 2 121434820 missense probably damaging 1.00
R2103:Pdia3 UTSW 2 121433993 missense probably damaging 1.00
R4160:Pdia3 UTSW 2 121414115 missense probably damaging 1.00
R4628:Pdia3 UTSW 2 121414139 missense possibly damaging 0.91
R5032:Pdia3 UTSW 2 121414139 missense probably benign 0.28
R5598:Pdia3 UTSW 2 121414130 missense possibly damaging 0.53
R5815:Pdia3 UTSW 2 121436411 nonsense probably null
R7162:Pdia3 UTSW 2 121429521 missense probably benign 0.00
X0012:Pdia3 UTSW 2 121435945 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CAATCGGCAGTTACCAGCTG -3'
(R):5'- TACCCTGGAGTTTAGGCTTTC -3'

Sequencing Primer
(F):5'- GCAGTTACCAGCTGTTCCG -3'
(R):5'- AGCCAGGCCTGCTAGATAGTG -3'
Posted On2016-07-22