Incidental Mutation 'R0417:Or8c16'
ID 40409
Institutional Source Beutler Lab
Gene Symbol Or8c16
Ensembl Gene ENSMUSG00000070311
Gene Name olfactory receptor family 8 subfamily C member 16
Synonyms Olfr894, MOR170-5, GA_x6K02T2PVTD-31898993-31899934
MMRRC Submission 038619-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.064) question?
Stock # R0417 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 38130114-38131062 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 38130751 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 211 (I211V)
Ref Sequence ENSEMBL: ENSMUSP00000091389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093866] [ENSMUST00000212992]
AlphaFold Q9EQB2
Predicted Effect probably benign
Transcript: ENSMUST00000093866
AA Change: I211V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000091389
Gene: ENSMUSG00000070311
AA Change: I211V

DomainStartEndE-ValueType
Pfam:7tm_4 34 310 8.8e-47 PFAM
Pfam:7tm_1 44 293 1.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212992
AA Change: I208V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 73,199,244 (GRCm39) K217R probably damaging Het
1810024B03Rik A G 2: 127,028,864 (GRCm39) Y112H probably damaging Het
Acot2 T C 12: 84,037,387 (GRCm39) Y234H probably benign Het
Alox12e C T 11: 70,212,691 (GRCm39) V53I probably benign Het
Ankrd50 T C 3: 38,510,510 (GRCm39) H619R probably damaging Het
Arfgef3 A T 10: 18,479,259 (GRCm39) L1452Q probably damaging Het
Arhgap42 T C 9: 9,180,034 (GRCm39) S82G possibly damaging Het
Arhgef18 T C 8: 3,438,957 (GRCm39) probably benign Het
Bicra C A 7: 15,706,247 (GRCm39) R1398L probably damaging Het
Boc T C 16: 44,340,597 (GRCm39) T118A probably benign Het
Btnl9 A G 11: 49,066,422 (GRCm39) Y381H probably damaging Het
Cbln3 T G 14: 56,121,586 (GRCm39) E20A probably benign Het
Cdc42ep5 A G 7: 4,154,482 (GRCm39) L102P probably damaging Het
Csrnp3 A G 2: 65,849,887 (GRCm39) Y171C probably benign Het
Cyp2d9 A T 15: 82,340,152 (GRCm39) I181F probably damaging Het
Cyp7b1 T A 3: 18,150,855 (GRCm39) T295S probably damaging Het
Dbn1 C T 13: 55,622,729 (GRCm39) E585K probably damaging Het
Dok1 A T 6: 83,008,550 (GRCm39) D377E probably damaging Het
Eed A T 7: 89,620,760 (GRCm39) Y87* probably null Het
Entpd3 T C 9: 120,386,487 (GRCm39) V156A probably damaging Het
Exo5 T A 4: 120,779,269 (GRCm39) T199S probably damaging Het
Extl2 T C 3: 115,818,006 (GRCm39) I106T probably benign Het
Ezh2 A G 6: 47,528,660 (GRCm39) C291R probably benign Het
Flvcr1 A T 1: 190,743,416 (GRCm39) M466K probably benign Het
Fras1 G T 5: 96,839,231 (GRCm39) M1583I probably benign Het
Fzd9 G T 5: 135,278,473 (GRCm39) R471S probably damaging Het
Galr1 A T 18: 82,423,665 (GRCm39) F204Y probably damaging Het
Gna11 A T 10: 81,366,738 (GRCm39) I324N probably damaging Het
Gucy1a2 A G 9: 3,759,484 (GRCm39) E430G possibly damaging Het
Hhatl C T 9: 121,617,828 (GRCm39) A254T probably benign Het
Ikzf1 A C 11: 11,719,352 (GRCm39) N353T probably benign Het
Il7 T A 3: 7,641,087 (GRCm39) T110S probably damaging Het
Keg1 A G 19: 12,688,424 (GRCm39) N53D probably damaging Het
Klhl21 T C 4: 152,099,964 (GRCm39) I558T probably damaging Het
Lca5l G A 16: 95,963,853 (GRCm39) T357M probably damaging Het
Lrba T C 3: 86,622,961 (GRCm39) S2448P probably damaging Het
Map3k6 T A 4: 132,975,393 (GRCm39) Y709* probably null Het
Megf6 A G 4: 154,352,424 (GRCm39) E1261G probably benign Het
Mettl3 C T 14: 52,534,155 (GRCm39) G473D probably damaging Het
Mga A G 2: 119,733,271 (GRCm39) I40V probably damaging Het
Mmp13 T A 9: 7,276,602 (GRCm39) D232E probably benign Het
Nampt T C 12: 32,883,100 (GRCm39) V95A probably benign Het
Nbeal1 T C 1: 60,286,893 (GRCm39) V905A probably benign Het
Nomo1 A T 7: 45,718,122 (GRCm39) E840V possibly damaging Het
Nprl2 A T 9: 107,420,497 (GRCm39) I101F probably damaging Het
Nup160 A T 2: 90,565,771 (GRCm39) I1378F possibly damaging Het
Ogdhl T C 14: 32,048,936 (GRCm39) S69P probably damaging Het
Or2y17 T A 11: 49,231,500 (GRCm39) I47N possibly damaging Het
Or4a68 C A 2: 89,270,519 (GRCm39) V35L possibly damaging Het
Or4k77 A G 2: 111,199,450 (GRCm39) S158G possibly damaging Het
Or5be3 A T 2: 86,863,789 (GRCm39) Y259N probably damaging Het
Or8b12i G A 9: 20,082,510 (GRCm39) A119V probably damaging Het
Or8c8 T C 9: 38,165,160 (GRCm39) F149S probably benign Het
Osbpl3 C T 6: 50,324,998 (GRCm39) V167I probably benign Het
Pclo T A 5: 14,763,036 (GRCm39) H3836Q unknown Het
Prkcg A T 7: 3,352,820 (GRCm39) probably null Het
Ror1 A T 4: 100,269,197 (GRCm39) H345L possibly damaging Het
Slc36a2 C T 11: 55,072,370 (GRCm39) probably null Het
Slc40a1 G A 1: 45,950,534 (GRCm39) P306L possibly damaging Het
Slc9a8 C A 2: 167,299,264 (GRCm39) T239K probably benign Het
Snapc3 A G 4: 83,368,399 (GRCm39) I299V probably benign Het
Sp3 G A 2: 72,801,845 (GRCm39) A56V possibly damaging Het
Spag17 T A 3: 99,972,870 (GRCm39) S1361T probably benign Het
Sptbn2 A G 19: 4,787,954 (GRCm39) T978A probably benign Het
Stom C A 2: 35,211,644 (GRCm39) V126F probably damaging Het
Stpg2 A G 3: 138,924,082 (GRCm39) T162A probably damaging Het
Stxbp6 G A 12: 44,949,740 (GRCm39) T63M probably damaging Het
Tatdn1 A C 15: 58,793,199 (GRCm39) I69S probably benign Het
Tbata A T 10: 61,016,118 (GRCm39) D198V probably damaging Het
Tbc1d5 T C 17: 51,063,733 (GRCm39) I638V probably benign Het
Tomm70a A G 16: 56,970,266 (GRCm39) D548G probably benign Het
Ust A G 10: 8,121,700 (GRCm39) F303L probably damaging Het
Vps13d A G 4: 144,703,130 (GRCm39) S4306P probably benign Het
Zbed6 A T 1: 133,586,276 (GRCm39) S354T probably benign Het
Zfp691 A G 4: 119,027,693 (GRCm39) S180P possibly damaging Het
Other mutations in Or8c16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Or8c16 APN 9 38,131,039 (GRCm39) missense probably benign 0.18
IGL01772:Or8c16 APN 9 38,130,905 (GRCm39) missense probably damaging 0.97
IGL02253:Or8c16 APN 9 38,131,031 (GRCm39) missense probably benign 0.01
IGL02279:Or8c16 APN 9 38,130,389 (GRCm39) missense probably benign 0.00
IGL03031:Or8c16 APN 9 38,130,361 (GRCm39) missense probably damaging 0.99
IGL03163:Or8c16 APN 9 38,130,710 (GRCm39) missense probably benign 0.00
R0458:Or8c16 UTSW 9 38,130,344 (GRCm39) missense probably damaging 0.97
R1498:Or8c16 UTSW 9 38,130,676 (GRCm39) missense probably damaging 1.00
R1765:Or8c16 UTSW 9 38,130,548 (GRCm39) missense probably benign 0.01
R2020:Or8c16 UTSW 9 38,130,728 (GRCm39) missense possibly damaging 0.47
R2282:Or8c16 UTSW 9 38,130,124 (GRCm39) missense probably benign 0.01
R3928:Or8c16 UTSW 9 38,130,131 (GRCm39) start codon destroyed probably null 0.63
R4716:Or8c16 UTSW 9 38,130,714 (GRCm39) missense probably damaging 0.99
R4911:Or8c16 UTSW 9 38,130,392 (GRCm39) missense probably damaging 0.99
R5148:Or8c16 UTSW 9 38,130,317 (GRCm39) missense probably benign 0.01
R7677:Or8c16 UTSW 9 38,130,324 (GRCm39) missense probably damaging 1.00
R7971:Or8c16 UTSW 9 38,130,843 (GRCm39) missense probably benign 0.00
R8219:Or8c16 UTSW 9 38,130,668 (GRCm39) missense probably damaging 0.98
R8754:Or8c16 UTSW 9 38,130,865 (GRCm39) missense possibly damaging 0.56
R9248:Or8c16 UTSW 9 38,130,706 (GRCm39) missense probably benign 0.04
R9256:Or8c16 UTSW 9 38,130,498 (GRCm39) nonsense probably null
R9352:Or8c16 UTSW 9 38,130,683 (GRCm39) missense probably damaging 1.00
R9593:Or8c16 UTSW 9 38,130,868 (GRCm39) missense probably benign 0.20
X0050:Or8c16 UTSW 9 38,130,446 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAGCAATGGCCTATGATCGCTATG -3'
(R):5'- TGACCCACTGTTTCAGCAGATGATG -3'

Sequencing Primer
(F):5'- ACCAGGTTGTTATGTCTCCTAAG -3'
(R):5'- CACTGTTTCAGCAGATGATGGATTG -3'
Posted On 2013-05-23