Incidental Mutation 'R5279:Tyw3'
ID404094
Institutional Source Beutler Lab
Gene Symbol Tyw3
Ensembl Gene ENSMUSG00000047583
Gene NametRNA-yW synthesizing protein 3 homolog (S. cerevisiae)
Synonyms5230400J09Rik
MMRRC Submission 042839-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R5279 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location154576431-154597104 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 154594471 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 80 (C80R)
Ref Sequence ENSEMBL: ENSMUSP00000057828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029850] [ENSMUST00000052774] [ENSMUST00000122976] [ENSMUST00000135723] [ENSMUST00000140644] [ENSMUST00000144764] [ENSMUST00000155232] [ENSMUST00000155385] [ENSMUST00000170461] [ENSMUST00000184537] [ENSMUST00000192462] [ENSMUST00000194876]
Predicted Effect probably benign
Transcript: ENSMUST00000029850
SMART Domains Protein: ENSMUSP00000029850
Gene: ENSMUSG00000028199

DomainStartEndE-ValueType
Pfam:ADH_N 35 131 3.3e-14 PFAM
Pfam:ADH_zinc_N 160 290 1.3e-30 PFAM
Pfam:ADH_zinc_N_2 192 329 1.7e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000052774
AA Change: C80R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000057828
Gene: ENSMUSG00000047583
AA Change: C80R

DomainStartEndE-ValueType
Pfam:TYW3 9 194 8.1e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122976
AA Change: C103R

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114437
Gene: ENSMUSG00000047583
AA Change: C103R

DomainStartEndE-ValueType
Pfam:TYW3 31 149 4.4e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135723
SMART Domains Protein: ENSMUSP00000143311
Gene: ENSMUSG00000028199

DomainStartEndE-ValueType
PDB:1YB5|B 1 38 5e-17 PDB
SCOP:d1qora1 9 38 9e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140644
SMART Domains Protein: ENSMUSP00000115146
Gene: ENSMUSG00000028199

DomainStartEndE-ValueType
Pfam:ADH_N 35 98 1.5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144764
SMART Domains Protein: ENSMUSP00000121269
Gene: ENSMUSG00000028199

DomainStartEndE-ValueType
Pfam:ADH_N 35 132 2.6e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148680
Predicted Effect probably benign
Transcript: ENSMUST00000155232
SMART Domains Protein: ENSMUSP00000118449
Gene: ENSMUSG00000028199

DomainStartEndE-ValueType
Pfam:ADH_N 35 135 3.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155385
SMART Domains Protein: ENSMUSP00000122619
Gene: ENSMUSG00000028199

DomainStartEndE-ValueType
Pfam:ADH_N 35 130 2.1e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170461
AA Change: C80R

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131461
Gene: ENSMUSG00000047583
AA Change: C80R

DomainStartEndE-ValueType
Pfam:TYW3 8 144 8.1e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184537
SMART Domains Protein: ENSMUSP00000139387
Gene: ENSMUSG00000028199

DomainStartEndE-ValueType
Pfam:ADH_N 35 180 4.7e-17 PFAM
Pfam:ADH_zinc_N 160 218 5.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192462
SMART Domains Protein: ENSMUSP00000142105
Gene: ENSMUSG00000028199

DomainStartEndE-ValueType
Pfam:ADH_N 35 131 2.8e-16 PFAM
Pfam:ADH_zinc_N 160 290 1.8e-29 PFAM
Pfam:ADH_zinc_N_2 192 329 4.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194876
SMART Domains Protein: ENSMUSP00000142101
Gene: ENSMUSG00000028199

DomainStartEndE-ValueType
Pfam:ADH_N 35 139 2.2e-14 PFAM
Pfam:ADH_zinc_N 160 290 1.4e-27 PFAM
Meta Mutation Damage Score 0.7391 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Wybutosine (yW) is a hypermodified guanosine at the 3-prime position adjacent to the anticodon of phenylalanine tRNA that stabilizes codon-anticodon interactions during decoding on the ribosome. TYW3 is the human homolog of a yeast gene essential for yW synthesis (Noma and Suzuki, 2006).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 C A 17: 24,289,414 G1049V probably damaging Het
Afdn G A 17: 13,888,952 R1579H probably damaging Het
Ankrd28 T A 14: 31,735,006 N386Y probably damaging Het
Atf7ip T A 6: 136,603,379 Y1100* probably null Het
Atp9b T A 18: 80,912,858 E3V probably damaging Het
AW554918 T G 18: 25,175,431 D60E possibly damaging Het
Baz2b G T 2: 59,932,152 Q927K probably damaging Het
Birc6 A G 17: 74,650,047 R3659G probably damaging Het
C8a T G 4: 104,845,988 N291H probably damaging Het
Calcoco1 G A 15: 102,710,985 L390F probably damaging Het
Carmil3 A G 14: 55,501,571 D894G probably damaging Het
Cdc20 A G 4: 118,433,514 Y430H probably damaging Het
Cdc6 A T 11: 98,912,262 I316F probably damaging Het
Cenpu T A 8: 46,578,910 probably null Het
Csmd2 T A 4: 128,456,914 V1592D probably benign Het
Csmd3 G T 15: 48,791,944 probably null Het
Dnah7c T C 1: 46,519,269 F512L probably benign Het
Fam136a T A 6: 86,366,704 L61Q probably damaging Het
Fpgs A C 2: 32,692,767 probably benign Het
Fzd4 G A 7: 89,407,673 M309I probably benign Het
Gad2 A G 2: 22,673,957 T391A probably benign Het
Gm11563 A T 11: 99,658,713 S72T unknown Het
Gm5155 T A 7: 17,873,289 noncoding transcript Het
Gon4l A G 3: 88,887,637 I716V probably benign Het
Itga9 T C 9: 118,628,205 V128A probably damaging Het
Kat6a CGCAGCAGCAGCAGCAGCA CGCAGCAGCAGCA 8: 22,939,648 probably benign Het
Lrrc9 T A 12: 72,495,594 D1063E possibly damaging Het
Lyst T A 13: 13,648,802 L1453* probably null Het
Mcm3ap T C 10: 76,507,539 V1755A probably damaging Het
Mrc1 T C 2: 14,310,058 S985P probably damaging Het
Mst1 A C 9: 108,082,215 K233N probably damaging Het
Nr2c2ap G A 8: 70,132,003 D42N probably damaging Het
Ntn1 A G 11: 68,385,712 S137P probably benign Het
Pard3 T C 8: 127,460,386 probably null Het
Pcdh15 T A 10: 74,594,183 D1210E probably damaging Het
Pcdhga5 T C 18: 37,694,721 L74P probably benign Het
Pcsk5 T C 19: 17,595,658 probably null Het
Pdia3 T C 2: 121,414,003 probably benign Het
Pikfyve A T 1: 65,196,699 R177* probably null Het
Pklr A G 3: 89,143,259 E409G probably damaging Het
Plod2 T C 9: 92,581,323 Y154H probably damaging Het
Psmc3 T A 2: 91,054,322 D6E probably benign Het
Ptpru T A 4: 131,820,023 N205I possibly damaging Het
Rbm6 T C 9: 107,778,014 E1006G probably benign Het
Rgl2 T C 17: 33,935,948 V642A probably benign Het
Rnf8 T A 17: 29,626,706 H104Q possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Rpa1 T C 11: 75,313,344 N269S probably damaging Het
Sdk2 A G 11: 113,867,031 M519T probably benign Het
Snx30 A G 4: 59,885,070 S237G probably benign Het
Spx A G 6: 142,414,040 N36S probably damaging Het
Stard7 T C 2: 127,295,496 Y289H probably damaging Het
Sugp2 T C 8: 70,257,107 probably benign Het
Susd4 C T 1: 182,887,478 T288I probably damaging Het
Tceanc2 T A 4: 107,177,629 probably null Het
Tm4sf4 T G 3: 57,433,738 V97G probably benign Het
Tmtc1 C T 6: 148,355,131 probably benign Het
Trappc11 C T 8: 47,505,304 probably benign Het
Triobp G T 15: 78,994,391 V398F possibly damaging Het
Ttll9 T A 2: 152,962,544 S2T possibly damaging Het
Ttn T C 2: 76,900,976 probably benign Het
Usp24 T C 4: 106,385,424 V1177A possibly damaging Het
Vmn1r65 A G 7: 6,008,755 V160A probably damaging Het
Vmn2r104 T A 17: 20,041,884 H328L probably benign Het
Vmn2r65 A C 7: 84,940,641 I689S probably damaging Het
Wrn A G 8: 33,241,101 Y1068H probably damaging Het
Xpo4 C A 14: 57,613,409 S346I probably benign Het
Zc3h3 T A 15: 75,839,590 T341S probably benign Het
Zxdc T C 6: 90,370,437 M260T possibly damaging Het
Other mutations in Tyw3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02444:Tyw3 APN 3 154596989 missense probably damaging 0.98
IGL03226:Tyw3 APN 3 154587550 missense possibly damaging 0.82
R0211:Tyw3 UTSW 3 154587495 missense probably damaging 1.00
R0211:Tyw3 UTSW 3 154587495 missense probably damaging 1.00
R1348:Tyw3 UTSW 3 154593814 missense possibly damaging 0.47
R1443:Tyw3 UTSW 3 154587523 missense probably benign 0.01
R1538:Tyw3 UTSW 3 154596869 missense probably damaging 0.98
R4289:Tyw3 UTSW 3 154597008 missense probably damaging 1.00
R6090:Tyw3 UTSW 3 154597067 missense probably benign 0.01
R6982:Tyw3 UTSW 3 154580230 missense probably benign 0.01
R7079:Tyw3 UTSW 3 154593789 missense probably benign 0.04
R7080:Tyw3 UTSW 3 154593789 missense probably benign 0.04
R7090:Tyw3 UTSW 3 154593789 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GCAGAGTGAAGTCCCTTCTTC -3'
(R):5'- CCATCTGAGCCCTAAGTTACTTG -3'

Sequencing Primer
(F):5'- atttgaacccagTGAGCC -3'
(R):5'- CTGAGCCCTAAGTTACTTGAATTG -3'
Posted On2016-07-22