Mutagenetix > Incidental Mutations

Incidental Mutation 'R5279:C8a'

404096

Institutional Source

Beutler Lab

Gene Symbol

C8a

Ensembl Gene

ENSMUSG00000035031

Gene Name

complement component 8, alpha polypeptide

Synonyms

MMRRC Submission

042839-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5279 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104815679-104876398 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 104845988 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Histidine at position 291 (N291H)

Ref Sequence

ENSEMBL: ENSMUSP00000102420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048947] [ENSMUST00000064873] [ENSMUST00000106808]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000048947
AA Change: N335H

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000047606
Gene: ENSMUSG00000035031
AA Change: N335H

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
TSP1	41	91	1.33e-1	SMART
LDLa	95	132	2.07e-11	SMART
MACPF	288	492	5.26e-58	SMART
Blast:EGF	496	529	3e-13	BLAST
Blast:TSP1	545	573	3e-12	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000064873
AA Change: N335H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000067541
Gene: ENSMUSG00000035031
AA Change: N335H

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
TSP1	41	91	1.33e-1	SMART
LDLa	95	132	2.07e-11	SMART
MACPF	288	492	5.26e-58	SMART
Blast:EGF	496	529	4e-13	BLAST
TSP1	545	587	1.86e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000106808
AA Change: N291H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102420
Gene: ENSMUSG00000035031
AA Change: N291H

Domain	Start	End	E-Value	Type
Blast:TSP1	4	47	3e-15	BLAST
LDLa	51	88	2.07e-11	SMART
MACPF	244	448	5.26e-58	SMART
Blast:EGF	452	485	4e-13	BLAST
Blast:TSP1	501	543	3e-22	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152146

Meta Mutation Damage Score

0.1089

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

99% (73/74)

MGI Phenotype

FUNCTION: This gene encodes the alpha subunit of complement component C8 that participates in the assembly of the complement membrane attack complex. The encoded preproprotein undergoes proteolytic processing to generate the alpha subunit, which associates with the beta and gamma subunits to form a trimeric complement component, C8. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. This gene is located adjacent to the gene encoding the beta subunit. [provided by RefSeq, Oct 2015]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca17	C	A	17: 24,289,414	G1049V	probably damaging	Het
Afdn	G	A	17: 13,888,952	R1579H	probably damaging	Het
Ankrd28	T	A	14: 31,735,006	N386Y	probably damaging	Het
Atf7ip	T	A	6: 136,603,379	Y1100*	probably null	Het
Atp9b	T	A	18: 80,912,858	E3V	probably damaging	Het
AW554918	T	G	18: 25,175,431	D60E	possibly damaging	Het
Baz2b	G	T	2: 59,932,152	Q927K	probably damaging	Het
Birc6	A	G	17: 74,650,047	R3659G	probably damaging	Het
Calcoco1	G	A	15: 102,710,985	L390F	probably damaging	Het
Carmil3	A	G	14: 55,501,571	D894G	probably damaging	Het
Cdc20	A	G	4: 118,433,514	Y430H	probably damaging	Het
Cdc6	A	T	11: 98,912,262	I316F	probably damaging	Het
Cenpu	T	A	8: 46,578,910		probably null	Het
Csmd2	T	A	4: 128,456,914	V1592D	probably benign	Het
Csmd3	G	T	15: 48,791,944		probably null	Het
Dnah7c	T	C	1: 46,519,269	F512L	probably benign	Het
Fam136a	T	A	6: 86,366,704	L61Q	probably damaging	Het
Fpgs	A	C	2: 32,692,767		probably benign	Het
Fzd4	G	A	7: 89,407,673	M309I	probably benign	Het
Gad2	A	G	2: 22,673,957	T391A	probably benign	Het
Gm11563	A	T	11: 99,658,713	S72T	unknown	Het
Gm5155	T	A	7: 17,873,289		noncoding transcript	Het
Gon4l	A	G	3: 88,887,637	I716V	probably benign	Het
Itga9	T	C	9: 118,628,205	V128A	probably damaging	Het
Kat6a	CGCAGCAGCAGCAGCAGCA	CGCAGCAGCAGCA	8: 22,939,648		probably benign	Het
Lrrc9	T	A	12: 72,495,594	D1063E	possibly damaging	Het
Lyst	T	A	13: 13,648,802	L1453*	probably null	Het
Mcm3ap	T	C	10: 76,507,539	V1755A	probably damaging	Het
Mrc1	T	C	2: 14,310,058	S985P	probably damaging	Het
Mst1	A	C	9: 108,082,215	K233N	probably damaging	Het
Nr2c2ap	G	A	8: 70,132,003	D42N	probably damaging	Het
Ntn1	A	G	11: 68,385,712	S137P	probably benign	Het
Pard3	T	C	8: 127,460,386		probably null	Het
Pcdh15	T	A	10: 74,594,183	D1210E	probably damaging	Het
Pcdhga5	T	C	18: 37,694,721	L74P	probably benign	Het
Pcsk5	T	C	19: 17,595,658		probably null	Het
Pdia3	T	C	2: 121,414,003		probably benign	Het
Pikfyve	A	T	1: 65,196,699	R177*	probably null	Het
Pklr	A	G	3: 89,143,259	E409G	probably damaging	Het
Plod2	T	C	9: 92,581,323	Y154H	probably damaging	Het
Psmc3	T	A	2: 91,054,322	D6E	probably benign	Het
Ptpru	T	A	4: 131,820,023	N205I	possibly damaging	Het
Rbm6	T	C	9: 107,778,014	E1006G	probably benign	Het
Rgl2	T	C	17: 33,935,948	V642A	probably benign	Het
Rnf8	T	A	17: 29,626,706	H104Q	possibly damaging	Het
Robo4	CGG	CG	9: 37,411,490		probably null	Het
Rpa1	T	C	11: 75,313,344	N269S	probably damaging	Het
Sdk2	A	G	11: 113,867,031	M519T	probably benign	Het
Snx30	A	G	4: 59,885,070	S237G	probably benign	Het
Spx	A	G	6: 142,414,040	N36S	probably damaging	Het
Stard7	T	C	2: 127,295,496	Y289H	probably damaging	Het
Sugp2	T	C	8: 70,257,107		probably benign	Het
Susd4	C	T	1: 182,887,478	T288I	probably damaging	Het
Tceanc2	T	A	4: 107,177,629		probably null	Het
Tm4sf4	T	G	3: 57,433,738	V97G	probably benign	Het
Tmtc1	C	T	6: 148,355,131		probably benign	Het
Trappc11	C	T	8: 47,505,304		probably benign	Het
Triobp	G	T	15: 78,994,391	V398F	possibly damaging	Het
Ttll9	T	A	2: 152,962,544	S2T	possibly damaging	Het
Ttn	T	C	2: 76,900,976		probably benign	Het
Tyw3	A	G	3: 154,594,471	C80R	probably damaging	Het
Usp24	T	C	4: 106,385,424	V1177A	possibly damaging	Het
Vmn1r65	A	G	7: 6,008,755	V160A	probably damaging	Het
Vmn2r104	T	A	17: 20,041,884	H328L	probably benign	Het
Vmn2r65	A	C	7: 84,940,641	I689S	probably damaging	Het
Wrn	A	G	8: 33,241,101	Y1068H	probably damaging	Het
Xpo4	C	A	14: 57,613,409	S346I	probably benign	Het
Zc3h3	T	A	15: 75,839,590	T341S	probably benign	Het
Zxdc	T	C	6: 90,370,437	M260T	possibly damaging	Het

Other mutations in C8a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00561:C8a	APN	4	104865445	intron	probably benign
IGL01326:C8a	APN	4	104856420	missense	probably damaging	1.00
IGL01339:C8a	APN	4	104827985	missense	probably benign	0.00
IGL01809:C8a	APN	4	104845942	missense	probably benign	0.06
IGL01843:C8a	APN	4	104862611	nonsense	probably null
IGL01988:C8a	APN	4	104826694	missense	probably damaging	1.00
IGL02187:C8a	APN	4	104862736	missense	probably damaging	1.00
IGL02430:C8a	APN	4	104817522	missense	probably damaging	0.97
IGL02537:C8a	APN	4	104845951	missense	probably damaging	1.00
derogation	UTSW	4	104828078	missense	possibly damaging	0.50
insult	UTSW	4	104828039	missense	probably benign	0.00
R0045:C8a	UTSW	4	104826815	missense	probably benign	0.00
R0045:C8a	UTSW	4	104826815	missense	probably benign	0.00
R0367:C8a	UTSW	4	104862594	critical splice donor site	probably null
R0632:C8a	UTSW	4	104856492	missense	probably damaging	1.00
R1013:C8a	UTSW	4	104828039	missense	probably benign	0.00
R1442:C8a	UTSW	4	104828078	missense	possibly damaging	0.50
R1902:C8a	UTSW	4	104856601	critical splice acceptor site	probably null
R2969:C8a	UTSW	4	104853777	missense	probably damaging	0.97
R3735:C8a	UTSW	4	104817615	missense	probably benign	0.43
R3736:C8a	UTSW	4	104817615	missense	probably benign	0.43
R4245:C8a	UTSW	4	104876346	missense	probably benign	0.00
R4707:C8a	UTSW	4	104856421	missense	probably damaging	1.00
R4812:C8a	UTSW	4	104862591	splice site	probably null
R5221:C8a	UTSW	4	104845925	missense	probably damaging	1.00
R5461:C8a	UTSW	4	104815845	utr 3 prime	probably benign
R5881:C8a	UTSW	4	104853932	missense	probably damaging	0.99
R6039:C8a	UTSW	4	104845942	missense	probably benign	0.00
R6039:C8a	UTSW	4	104845942	missense	probably benign	0.00
R6191:C8a	UTSW	4	104845903	missense	probably benign	0.00
R6626:C8a	UTSW	4	104845967	missense	probably benign	0.01
R7438:C8a	UTSW	4	104861429	missense	probably damaging	0.97
R7471:C8a	UTSW	4	104817625	missense	probably benign	0.01
R7514:C8a	UTSW	4	104846050	missense	possibly damaging	0.94
R7596:C8a	UTSW	4	104853867	missense	possibly damaging	0.49
X0012:C8a	UTSW	4	104826782	missense	probably damaging	1.00
X0019:C8a	UTSW	4	104817586	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGTAGACACTAACAGCATGC -3'
(R):5'- TTCGGATGCTGTCGGAAGA -3'

Sequencing Primer
(F):5'- GGAAAACTATCCCCTTGGTAGGATC -3'
(R):5'- AGATATGGCTTCATGAGAGTGTCTAC -3'

Posted On

2016-07-22