Mutagenetix > Incidental Mutations

Incidental Mutation 'R5279:Ptpru'

404100

Institutional Source

Beutler Lab

Gene Symbol

Ptpru

Ensembl Gene

ENSMUSG00000028909

Gene Name

protein tyrosine phosphatase, receptor type, U

Synonyms

Ptprl, RPTPlambda

MMRRC Submission

042839-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5279 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

131768457-131838288 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 131820023 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 205 (N205I)

Ref Sequence

ENSEMBL: ENSMUSP00000101607 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030741] [ENSMUST00000097860] [ENSMUST00000105987]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030741
AA Change: N205I

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000030741
Gene: ENSMUSG00000028909
AA Change: N205I

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
MAM	22	188	5.58e-68	SMART
IG	195	283	4.93e-3	SMART
FN3	285	368	3.79e-2	SMART
FN3	384	472	2.5e-2	SMART
FN3	488	576	3.62e-8	SMART
low complexity region	627	641	N/A	INTRINSIC
low complexity region	667	677	N/A	INTRINSIC
transmembrane domain	747	769	N/A	INTRINSIC
PTPc	893	1146	5.95e-102	SMART
PTPc	1175	1441	3.67e-93	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000097860
AA Change: N133I

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000095472
Gene: ENSMUSG00000028909
AA Change: N133I

Domain	Start	End	E-Value	Type
Pfam:MAM	1	116	4.1e-30	PFAM
IG	123	211	4.93e-3	SMART
FN3	213	296	3.79e-2	SMART
FN3	312	400	2.5e-2	SMART
FN3	416	504	3.62e-8	SMART
low complexity region	555	569	N/A	INTRINSIC
low complexity region	595	605	N/A	INTRINSIC
transmembrane domain	675	697	N/A	INTRINSIC
Blast:PTPc	736	878	3e-49	BLAST
SCOP:d1jlna_	790	886	9e-19	SMART
PDB:2C7S\|A	797	878	7e-22	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105987
AA Change: N205I

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000101607
Gene: ENSMUSG00000028909
AA Change: N205I

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
MAM	22	188	5.58e-68	SMART
IG	195	283	4.93e-3	SMART
FN3	285	368	3.79e-2	SMART
FN3	384	472	2.5e-2	SMART
FN3	488	576	3.62e-8	SMART
low complexity region	627	641	N/A	INTRINSIC
low complexity region	667	677	N/A	INTRINSIC
transmembrane domain	748	770	N/A	INTRINSIC
PTPc	883	1136	5.95e-102	SMART
PTPc	1165	1431	3.67e-93	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127633

Meta Mutation Damage Score

0.7608

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

99% (73/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. This PTP was thought to play roles in cell-cell recognition and adhesion. Studies of the similar gene in mice suggested the role of this PTP in early neural development. The expression of this gene was reported to be regulated by phorbol myristate acetate (PMA) or calcium ionophore in Jurkat T lymphoma cells. Alternatively spliced transcript variants have been reported. [provided by RefSeq, Aug 2010]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca17	C	A	17: 24,289,414	G1049V	probably damaging	Het
Afdn	G	A	17: 13,888,952	R1579H	probably damaging	Het
Ankrd28	T	A	14: 31,735,006	N386Y	probably damaging	Het
Atf7ip	T	A	6: 136,603,379	Y1100*	probably null	Het
Atp9b	T	A	18: 80,912,858	E3V	probably damaging	Het
AW554918	T	G	18: 25,175,431	D60E	possibly damaging	Het
Baz2b	G	T	2: 59,932,152	Q927K	probably damaging	Het
Birc6	A	G	17: 74,650,047	R3659G	probably damaging	Het
C8a	T	G	4: 104,845,988	N291H	probably damaging	Het
Calcoco1	G	A	15: 102,710,985	L390F	probably damaging	Het
Carmil3	A	G	14: 55,501,571	D894G	probably damaging	Het
Cdc20	A	G	4: 118,433,514	Y430H	probably damaging	Het
Cdc6	A	T	11: 98,912,262	I316F	probably damaging	Het
Cenpu	T	A	8: 46,578,910		probably null	Het
Csmd2	T	A	4: 128,456,914	V1592D	probably benign	Het
Csmd3	G	T	15: 48,791,944		probably null	Het
Dnah7c	T	C	1: 46,519,269	F512L	probably benign	Het
Fam136a	T	A	6: 86,366,704	L61Q	probably damaging	Het
Fpgs	A	C	2: 32,692,767		probably benign	Het
Fzd4	G	A	7: 89,407,673	M309I	probably benign	Het
Gad2	A	G	2: 22,673,957	T391A	probably benign	Het
Gm11563	A	T	11: 99,658,713	S72T	unknown	Het
Gm5155	T	A	7: 17,873,289		noncoding transcript	Het
Gon4l	A	G	3: 88,887,637	I716V	probably benign	Het
Itga9	T	C	9: 118,628,205	V128A	probably damaging	Het
Kat6a	CGCAGCAGCAGCAGCAGCA	CGCAGCAGCAGCA	8: 22,939,648		probably benign	Het
Lrrc9	T	A	12: 72,495,594	D1063E	possibly damaging	Het
Lyst	T	A	13: 13,648,802	L1453*	probably null	Het
Mcm3ap	T	C	10: 76,507,539	V1755A	probably damaging	Het
Mrc1	T	C	2: 14,310,058	S985P	probably damaging	Het
Mst1	A	C	9: 108,082,215	K233N	probably damaging	Het
Nr2c2ap	G	A	8: 70,132,003	D42N	probably damaging	Het
Ntn1	A	G	11: 68,385,712	S137P	probably benign	Het
Pard3	T	C	8: 127,460,386		probably null	Het
Pcdh15	T	A	10: 74,594,183	D1210E	probably damaging	Het
Pcdhga5	T	C	18: 37,694,721	L74P	probably benign	Het
Pcsk5	T	C	19: 17,595,658		probably null	Het
Pdia3	T	C	2: 121,414,003		probably benign	Het
Pikfyve	A	T	1: 65,196,699	R177*	probably null	Het
Pklr	A	G	3: 89,143,259	E409G	probably damaging	Het
Plod2	T	C	9: 92,581,323	Y154H	probably damaging	Het
Psmc3	T	A	2: 91,054,322	D6E	probably benign	Het
Rbm6	T	C	9: 107,778,014	E1006G	probably benign	Het
Rgl2	T	C	17: 33,935,948	V642A	probably benign	Het
Rnf8	T	A	17: 29,626,706	H104Q	possibly damaging	Het
Robo4	CGG	CG	9: 37,411,490		probably null	Het
Rpa1	T	C	11: 75,313,344	N269S	probably damaging	Het
Sdk2	A	G	11: 113,867,031	M519T	probably benign	Het
Snx30	A	G	4: 59,885,070	S237G	probably benign	Het
Spx	A	G	6: 142,414,040	N36S	probably damaging	Het
Stard7	T	C	2: 127,295,496	Y289H	probably damaging	Het
Sugp2	T	C	8: 70,257,107		probably benign	Het
Susd4	C	T	1: 182,887,478	T288I	probably damaging	Het
Tceanc2	T	A	4: 107,177,629		probably null	Het
Tm4sf4	T	G	3: 57,433,738	V97G	probably benign	Het
Tmtc1	C	T	6: 148,355,131		probably benign	Het
Trappc11	C	T	8: 47,505,304		probably benign	Het
Triobp	G	T	15: 78,994,391	V398F	possibly damaging	Het
Ttll9	T	A	2: 152,962,544	S2T	possibly damaging	Het
Ttn	T	C	2: 76,900,976		probably benign	Het
Tyw3	A	G	3: 154,594,471	C80R	probably damaging	Het
Usp24	T	C	4: 106,385,424	V1177A	possibly damaging	Het
Vmn1r65	A	G	7: 6,008,755	V160A	probably damaging	Het
Vmn2r104	T	A	17: 20,041,884	H328L	probably benign	Het
Vmn2r65	A	C	7: 84,940,641	I689S	probably damaging	Het
Wrn	A	G	8: 33,241,101	Y1068H	probably damaging	Het
Xpo4	C	A	14: 57,613,409	S346I	probably benign	Het
Zc3h3	T	A	15: 75,839,590	T341S	probably benign	Het
Zxdc	T	C	6: 90,370,437	M260T	possibly damaging	Het

Other mutations in Ptpru

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Ptpru	APN	4	131808235	missense	probably benign	0.00
IGL00966:Ptpru	APN	4	131772616	missense	probably damaging	1.00
IGL01451:Ptpru	APN	4	131769492	utr 3 prime	probably benign
IGL01453:Ptpru	APN	4	131769492	utr 3 prime	probably benign
IGL01606:Ptpru	APN	4	131808481	missense	possibly damaging	0.69
IGL02451:Ptpru	APN	4	131776775	splice site	probably benign
IGL03135:Ptpru	APN	4	131818800	missense	probably damaging	0.97
IGL03366:Ptpru	APN	4	131779867	missense	probably damaging	1.00
PIT4366001:Ptpru	UTSW	4	131799712	missense	probably benign	0.03
PIT4576001:Ptpru	UTSW	4	131802544	nonsense	probably null
R0299:Ptpru	UTSW	4	131803387	nonsense	probably null
R0458:Ptpru	UTSW	4	131799675	missense	possibly damaging	0.49
R0502:Ptpru	UTSW	4	131793643	missense	probably benign	0.02
R0503:Ptpru	UTSW	4	131793643	missense	probably benign	0.02
R0619:Ptpru	UTSW	4	131820887	missense	possibly damaging	0.91
R0639:Ptpru	UTSW	4	131771179	missense	possibly damaging	0.49
R0843:Ptpru	UTSW	4	131797948	missense	probably benign	0.10
R1065:Ptpru	UTSW	4	131808340	missense	possibly damaging	0.49
R1170:Ptpru	UTSW	4	131808527	splice site	probably benign
R1382:Ptpru	UTSW	4	131808229	missense	probably damaging	0.98
R1442:Ptpru	UTSW	4	131808269	missense	probably benign	0.00
R1538:Ptpru	UTSW	4	131774351	missense	probably damaging	0.99
R1624:Ptpru	UTSW	4	131772550	missense	probably damaging	1.00
R1688:Ptpru	UTSW	4	131787345	missense	probably benign	0.01
R1699:Ptpru	UTSW	4	131779050	missense	probably damaging	1.00
R1740:Ptpru	UTSW	4	131793678	splice site	probably null
R1874:Ptpru	UTSW	4	131769755	missense	probably benign
R1959:Ptpru	UTSW	4	131803477	missense	probably damaging	1.00
R2051:Ptpru	UTSW	4	131819087	missense	possibly damaging	0.80
R2200:Ptpru	UTSW	4	131820813	missense	probably damaging	1.00
R2281:Ptpru	UTSW	4	131808499	missense	probably damaging	1.00
R2304:Ptpru	UTSW	4	131772568	missense	probably damaging	1.00
R2411:Ptpru	UTSW	4	131771469	missense	probably damaging	1.00
R2845:Ptpru	UTSW	4	131819661	missense	probably benign	0.00
R3767:Ptpru	UTSW	4	131808424	missense	probably damaging	1.00
R3768:Ptpru	UTSW	4	131808424	missense	probably damaging	1.00
R3769:Ptpru	UTSW	4	131808424	missense	probably damaging	1.00
R3770:Ptpru	UTSW	4	131808424	missense	probably damaging	1.00
R3937:Ptpru	UTSW	4	131774304	missense	probably damaging	0.99
R4079:Ptpru	UTSW	4	131798710	critical splice donor site	probably null
R4110:Ptpru	UTSW	4	131819037	missense	probably damaging	1.00
R4170:Ptpru	UTSW	4	131776348	missense	probably damaging	1.00
R4716:Ptpru	UTSW	4	131820968	missense	probably benign
R4751:Ptpru	UTSW	4	131802586	missense	probably damaging	0.97
R4766:Ptpru	UTSW	4	131820964	missense	probably damaging	1.00
R4825:Ptpru	UTSW	4	131799603	missense	probably benign
R4900:Ptpru	UTSW	4	131788382	missense	probably damaging	0.99
R4998:Ptpru	UTSW	4	131776885	missense	probably damaging	1.00
R5464:Ptpru	UTSW	4	131772557	missense	probably damaging	1.00
R5625:Ptpru	UTSW	4	131803380	missense	probably null	1.00
R5667:Ptpru	UTSW	4	131820190	missense	possibly damaging	0.94
R5671:Ptpru	UTSW	4	131820190	missense	possibly damaging	0.94
R5735:Ptpru	UTSW	4	131838090	missense	probably benign	0.01
R5802:Ptpru	UTSW	4	131788377	missense	possibly damaging	0.84
R5809:Ptpru	UTSW	4	131785756	missense	probably benign	0.34
R5953:Ptpru	UTSW	4	131776837	missense	probably damaging	1.00
R5973:Ptpru	UTSW	4	131818925	missense	probably benign	0.00
R6029:Ptpru	UTSW	4	131771293	missense	probably damaging	1.00
R6072:Ptpru	UTSW	4	131776228	missense	probably damaging	0.99
R6089:Ptpru	UTSW	4	131772630	missense	possibly damaging	0.94
R6174:Ptpru	UTSW	4	131785754	missense	probably benign
R6177:Ptpru	UTSW	4	131793525	missense	probably benign	0.00
R6367:Ptpru	UTSW	4	131774352	missense	probably benign	0.18
R6682:Ptpru	UTSW	4	131820782	missense	probably benign
R6950:Ptpru	UTSW	4	131776352	missense	probably damaging	0.99
R7159:Ptpru	UTSW	4	131819540	missense	probably damaging	1.00
R7736:Ptpru	UTSW	4	131788382	missense	probably damaging	1.00
R7960:Ptpru	UTSW	4	131788509	missense	probably benign	0.01
R8094:Ptpru	UTSW	4	131793592	missense	possibly damaging	0.88
R8262:Ptpru	UTSW	4	131794963	nonsense	probably null
R8276:Ptpru	UTSW	4	131779173	missense	probably damaging	1.00
R8355:Ptpru	UTSW	4	131808500	missense	probably damaging	1.00
R8377:Ptpru	UTSW	4	131808335	missense	probably damaging	1.00
R8416:Ptpru	UTSW	4	131808472	missense	probably damaging	1.00
X0024:Ptpru	UTSW	4	131771190	missense	probably benign	0.15
Z1177:Ptpru	UTSW	4	131799706	missense	probably benign	0.00
Z1177:Ptpru	UTSW	4	131808262	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCCCAGAGTTAAGGGGATGC -3'
(R):5'- AGACGACATCTTGCTCTTCAG -3'

Sequencing Primer
(F):5'- TGGCAGAGCACAGCCTAG -3'
(R):5'- TTCAGCTATCCCTGCGGTGAG -3'

Posted On

2016-07-22