Incidental Mutation 'R5279:Atf7ip'
ID 404103
Institutional Source Beutler Lab
Gene Symbol Atf7ip
Ensembl Gene ENSMUSG00000030213
Gene Name activating transcription factor 7 interacting protein
Synonyms ATFa-associated Modulator, AM, 2610204M12Rik, Mcaf1
MMRRC Submission 042839-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.918) question?
Stock # R5279 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 136495787-136587848 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 136580377 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 1100 (Y1100*)
Ref Sequence ENSEMBL: ENSMUSP00000032335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032335]
AlphaFold Q7TT18
Predicted Effect probably null
Transcript: ENSMUST00000032335
AA Change: Y1100*
SMART Domains Protein: ENSMUSP00000032335
Gene: ENSMUSG00000030213
AA Change: Y1100*

DomainStartEndE-ValueType
internal_repeat_1 123 144 9.59e-5 PROSPERO
internal_repeat_1 143 164 9.59e-5 PROSPERO
low complexity region 184 212 N/A INTRINSIC
low complexity region 246 262 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 409 427 N/A INTRINSIC
low complexity region 567 582 N/A INTRINSIC
Pfam:ATF7IP_BD 598 813 5.5e-62 PFAM
low complexity region 864 889 N/A INTRINSIC
PDB:2RPQ|B 974 1017 5e-7 PDB
low complexity region 1022 1036 N/A INTRINSIC
low complexity region 1038 1050 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
low complexity region 1168 1192 N/A INTRINSIC
FN3 1194 1288 3.4e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185332
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ATF7IP is a multifunctional nuclear protein that associates with heterochromatin. It can act as a transcriptional coactivator or corepressor depending upon its binding partners (summary by Liu et al., 2009 [PubMed 19106100]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 C A 17: 24,508,388 (GRCm39) G1049V probably damaging Het
Afdn G A 17: 14,109,214 (GRCm39) R1579H probably damaging Het
Ankrd28 T A 14: 31,456,963 (GRCm39) N386Y probably damaging Het
Atp9b T A 18: 80,956,073 (GRCm39) E3V probably damaging Het
AW554918 T G 18: 25,308,488 (GRCm39) D60E possibly damaging Het
Baz2b G T 2: 59,762,496 (GRCm39) Q927K probably damaging Het
Birc6 A G 17: 74,957,042 (GRCm39) R3659G probably damaging Het
C8a T G 4: 104,703,185 (GRCm39) N291H probably damaging Het
Calcoco1 G A 15: 102,619,420 (GRCm39) L390F probably damaging Het
Carmil3 A G 14: 55,739,028 (GRCm39) D894G probably damaging Het
Cdc20 A G 4: 118,290,711 (GRCm39) Y430H probably damaging Het
Cdc6 A T 11: 98,803,088 (GRCm39) I316F probably damaging Het
Ceacam23 T A 7: 17,607,214 (GRCm39) noncoding transcript Het
Cenpu T A 8: 47,031,945 (GRCm39) probably null Het
Csmd2 T A 4: 128,350,707 (GRCm39) V1592D probably benign Het
Csmd3 G T 15: 48,655,340 (GRCm39) probably null Het
Dnah7c T C 1: 46,558,429 (GRCm39) F512L probably benign Het
Fam136a T A 6: 86,343,686 (GRCm39) L61Q probably damaging Het
Fpgs A C 2: 32,582,779 (GRCm39) probably benign Het
Fzd4 G A 7: 89,056,881 (GRCm39) M309I probably benign Het
Gad2 A G 2: 22,563,969 (GRCm39) T391A probably benign Het
Gm11563 A T 11: 99,549,539 (GRCm39) S72T unknown Het
Gon4l A G 3: 88,794,944 (GRCm39) I716V probably benign Het
Itga9 T C 9: 118,457,273 (GRCm39) V128A probably damaging Het
Kat6a CGCAGCAGCAGCAGCAGCA CGCAGCAGCAGCA 8: 23,429,664 (GRCm39) probably benign Het
Lrrc9 T A 12: 72,542,368 (GRCm39) D1063E possibly damaging Het
Lyst T A 13: 13,823,387 (GRCm39) L1453* probably null Het
Mcm3ap T C 10: 76,343,373 (GRCm39) V1755A probably damaging Het
Mrc1 T C 2: 14,314,869 (GRCm39) S985P probably damaging Het
Mst1 A C 9: 107,959,414 (GRCm39) K233N probably damaging Het
Nr2c2ap G A 8: 70,584,653 (GRCm39) D42N probably damaging Het
Ntn1 A G 11: 68,276,538 (GRCm39) S137P probably benign Het
Pard3 T C 8: 128,186,867 (GRCm39) probably null Het
Pcdh15 T A 10: 74,430,015 (GRCm39) D1210E probably damaging Het
Pcdhga5 T C 18: 37,827,774 (GRCm39) L74P probably benign Het
Pcsk5 T C 19: 17,573,022 (GRCm39) probably null Het
Pdia3 T C 2: 121,244,484 (GRCm39) probably benign Het
Pikfyve A T 1: 65,235,858 (GRCm39) R177* probably null Het
Pklr A G 3: 89,050,566 (GRCm39) E409G probably damaging Het
Plod2 T C 9: 92,463,376 (GRCm39) Y154H probably damaging Het
Psmc3 T A 2: 90,884,667 (GRCm39) D6E probably benign Het
Ptpru T A 4: 131,547,334 (GRCm39) N205I possibly damaging Het
Rbm6 T C 9: 107,655,213 (GRCm39) E1006G probably benign Het
Rgl2 T C 17: 34,154,922 (GRCm39) V642A probably benign Het
Rnf8 T A 17: 29,845,680 (GRCm39) H104Q possibly damaging Het
Robo4 CGG CG 9: 37,322,786 (GRCm39) probably null Het
Rpa1 T C 11: 75,204,170 (GRCm39) N269S probably damaging Het
Sdk2 A G 11: 113,757,857 (GRCm39) M519T probably benign Het
Snx30 A G 4: 59,885,070 (GRCm39) S237G probably benign Het
Spx A G 6: 142,359,766 (GRCm39) N36S probably damaging Het
Stard7 T C 2: 127,137,416 (GRCm39) Y289H probably damaging Het
Sugp2 T C 8: 70,709,757 (GRCm39) probably benign Het
Susd4 C T 1: 182,715,043 (GRCm39) T288I probably damaging Het
Tceanc2 T A 4: 107,034,826 (GRCm39) probably null Het
Tm4sf4 T G 3: 57,341,159 (GRCm39) V97G probably benign Het
Tmtc1 C T 6: 148,256,629 (GRCm39) probably benign Het
Trappc11 C T 8: 47,958,339 (GRCm39) probably benign Het
Triobp G T 15: 78,878,591 (GRCm39) V398F possibly damaging Het
Ttll9 T A 2: 152,804,464 (GRCm39) S2T possibly damaging Het
Ttn T C 2: 76,731,320 (GRCm39) probably benign Het
Tyw3 A G 3: 154,300,108 (GRCm39) C80R probably damaging Het
Usp24 T C 4: 106,242,621 (GRCm39) V1177A possibly damaging Het
Vmn1r65 A G 7: 6,011,754 (GRCm39) V160A probably damaging Het
Vmn2r104 T A 17: 20,262,146 (GRCm39) H328L probably benign Het
Vmn2r65 A C 7: 84,589,849 (GRCm39) I689S probably damaging Het
Wrn A G 8: 33,731,129 (GRCm39) Y1068H probably damaging Het
Xpo4 C A 14: 57,850,866 (GRCm39) S346I probably benign Het
Zc3h3 T A 15: 75,711,439 (GRCm39) T341S probably benign Het
Zxdc T C 6: 90,347,419 (GRCm39) M260T possibly damaging Het
Other mutations in Atf7ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Atf7ip APN 6 136,537,679 (GRCm39) missense probably benign 0.00
IGL01483:Atf7ip APN 6 136,564,457 (GRCm39) missense probably damaging 1.00
IGL02313:Atf7ip APN 6 136,583,718 (GRCm39) missense probably damaging 0.99
IGL02319:Atf7ip APN 6 136,570,116 (GRCm39) missense probably benign 0.01
IGL02547:Atf7ip APN 6 136,580,274 (GRCm39) splice site probably benign
IGL02869:Atf7ip APN 6 136,583,577 (GRCm39) missense probably damaging 0.99
IGL02895:Atf7ip APN 6 136,537,686 (GRCm39) missense probably damaging 0.99
IGL02967:Atf7ip APN 6 136,583,725 (GRCm39) missense probably damaging 0.98
IGL03026:Atf7ip APN 6 136,582,380 (GRCm39) missense possibly damaging 0.79
fuegado UTSW 6 136,537,708 (GRCm39) missense probably benign
Outtahere UTSW 6 136,542,104 (GRCm39) missense probably damaging 1.00
Severance UTSW 6 136,536,814 (GRCm39) missense probably damaging 1.00
R0024:Atf7ip UTSW 6 136,576,818 (GRCm39) splice site probably benign
R0045:Atf7ip UTSW 6 136,536,814 (GRCm39) missense probably damaging 1.00
R0045:Atf7ip UTSW 6 136,536,814 (GRCm39) missense probably damaging 1.00
R0325:Atf7ip UTSW 6 136,537,987 (GRCm39) missense possibly damaging 0.86
R0331:Atf7ip UTSW 6 136,538,161 (GRCm39) missense possibly damaging 0.94
R0415:Atf7ip UTSW 6 136,537,010 (GRCm39) missense possibly damaging 0.92
R0490:Atf7ip UTSW 6 136,586,190 (GRCm39) unclassified probably benign
R0526:Atf7ip UTSW 6 136,536,803 (GRCm39) missense probably damaging 1.00
R1503:Atf7ip UTSW 6 136,583,865 (GRCm39) missense probably damaging 0.96
R1663:Atf7ip UTSW 6 136,580,322 (GRCm39) missense possibly damaging 0.93
R1793:Atf7ip UTSW 6 136,586,217 (GRCm39) unclassified probably benign
R1822:Atf7ip UTSW 6 136,564,258 (GRCm39) missense probably benign 0.11
R1873:Atf7ip UTSW 6 136,536,886 (GRCm39) missense probably damaging 1.00
R1937:Atf7ip UTSW 6 136,537,778 (GRCm39) missense probably benign 0.41
R2059:Atf7ip UTSW 6 136,586,346 (GRCm39) unclassified probably benign
R2134:Atf7ip UTSW 6 136,582,485 (GRCm39) missense possibly damaging 0.80
R2679:Atf7ip UTSW 6 136,543,649 (GRCm39) missense possibly damaging 0.62
R3430:Atf7ip UTSW 6 136,552,322 (GRCm39) unclassified probably benign
R3755:Atf7ip UTSW 6 136,537,815 (GRCm39) missense probably benign 0.01
R3756:Atf7ip UTSW 6 136,537,815 (GRCm39) missense probably benign 0.01
R3890:Atf7ip UTSW 6 136,564,043 (GRCm39) missense possibly damaging 0.48
R4190:Atf7ip UTSW 6 136,564,499 (GRCm39) missense probably damaging 1.00
R4494:Atf7ip UTSW 6 136,540,747 (GRCm39) splice site probably null
R4588:Atf7ip UTSW 6 136,576,692 (GRCm39) missense probably benign
R4618:Atf7ip UTSW 6 136,542,104 (GRCm39) missense probably damaging 1.00
R4705:Atf7ip UTSW 6 136,538,192 (GRCm39) missense probably damaging 1.00
R4838:Atf7ip UTSW 6 136,573,489 (GRCm39) missense probably benign 0.06
R4922:Atf7ip UTSW 6 136,537,039 (GRCm39) missense possibly damaging 0.91
R4956:Atf7ip UTSW 6 136,583,808 (GRCm39) missense probably damaging 1.00
R4957:Atf7ip UTSW 6 136,583,808 (GRCm39) missense probably damaging 1.00
R4958:Atf7ip UTSW 6 136,583,808 (GRCm39) missense probably damaging 1.00
R5000:Atf7ip UTSW 6 136,559,426 (GRCm39) missense probably damaging 1.00
R5001:Atf7ip UTSW 6 136,538,386 (GRCm39) missense probably damaging 0.99
R5075:Atf7ip UTSW 6 136,537,232 (GRCm39) missense probably benign
R5445:Atf7ip UTSW 6 136,564,255 (GRCm39) missense probably damaging 1.00
R5844:Atf7ip UTSW 6 136,583,812 (GRCm39) missense probably damaging 1.00
R5850:Atf7ip UTSW 6 136,543,785 (GRCm39) critical splice donor site probably null
R5891:Atf7ip UTSW 6 136,536,975 (GRCm39) missense possibly damaging 0.64
R5987:Atf7ip UTSW 6 136,548,500 (GRCm39) missense probably damaging 1.00
R6168:Atf7ip UTSW 6 136,536,817 (GRCm39) missense probably damaging 1.00
R6726:Atf7ip UTSW 6 136,559,389 (GRCm39) missense probably damaging 1.00
R6880:Atf7ip UTSW 6 136,538,038 (GRCm39) missense probably damaging 1.00
R6924:Atf7ip UTSW 6 136,536,755 (GRCm39) splice site probably null
R7075:Atf7ip UTSW 6 136,573,513 (GRCm39) critical splice donor site probably null
R7308:Atf7ip UTSW 6 136,542,087 (GRCm39) missense probably benign 0.01
R7365:Atf7ip UTSW 6 136,537,708 (GRCm39) missense probably benign
R7556:Atf7ip UTSW 6 136,538,239 (GRCm39) missense probably damaging 0.99
R7812:Atf7ip UTSW 6 136,580,415 (GRCm39) missense probably damaging 0.96
R7973:Atf7ip UTSW 6 136,538,062 (GRCm39) nonsense probably null
R8032:Atf7ip UTSW 6 136,542,110 (GRCm39) missense probably benign 0.00
R8203:Atf7ip UTSW 6 136,583,781 (GRCm39) missense probably damaging 0.99
R8274:Atf7ip UTSW 6 136,537,988 (GRCm39) missense probably benign
R8784:Atf7ip UTSW 6 136,576,648 (GRCm39) missense probably damaging 0.99
R8785:Atf7ip UTSW 6 136,564,162 (GRCm39) missense probably damaging 0.97
R8885:Atf7ip UTSW 6 136,564,141 (GRCm39) missense probably benign 0.06
R8957:Atf7ip UTSW 6 136,543,701 (GRCm39) missense probably null 0.99
R9042:Atf7ip UTSW 6 136,538,263 (GRCm39) nonsense probably null
R9531:Atf7ip UTSW 6 136,537,875 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACATGTGGTTCTGACAGCC -3'
(R):5'- GTGCTGTTCCATATGTCCCTTAGTATG -3'

Sequencing Primer
(F):5'- ATGTGGTTCTGACAGCCCTTTTC -3'
(R):5'- ATAGAGCAGTACATACCCC -3'
Posted On 2016-07-22