Mutagenetix > Incidental Mutations

Incidental Mutation 'R5279:Robo4'

404118

Institutional Source

Beutler Lab

Gene Symbol

Robo4

Ensembl Gene

ENSMUSG00000032125

Gene Name

roundabout guidance receptor 4

Synonyms

1200012D01Rik, Magic roundabout

MMRRC Submission

042839-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.254) question?

Stock #

R5279 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

37401897-37415115 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

CGG to CG at 37411490 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000150722 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034643] [ENSMUST00000102895] [ENSMUST00000115038] [ENSMUST00000115046] [ENSMUST00000115048] [ENSMUST00000156972] [ENSMUST00000170512] [ENSMUST00000214185]

Predicted Effect

probably benign
Transcript: ENSMUST00000034643

SMART Domains

Protein: ENSMUSP00000034643
Gene: ENSMUSG00000032128

Domain	Start	End	E-Value	Type
IGc2	54	128	9.7e-11	SMART
IGc2	156	221	1.44e-4	SMART
IGc2	248	311	1.89e-13	SMART
IGc2	337	409	9.84e-12	SMART
IGc2	441	506	2.09e-15	SMART
FN3	534	616	4.24e-14	SMART
FN3	648	731	3.06e0	SMART
FN3	747	832	1.97e-9	SMART
low complexity region	870	890	N/A	INTRINSIC
low complexity region	1055	1082	N/A	INTRINSIC
low complexity region	1131	1149	N/A	INTRINSIC
low complexity region	1155	1169	N/A	INTRINSIC
low complexity region	1193	1206	N/A	INTRINSIC
low complexity region	1245	1256	N/A	INTRINSIC
low complexity region	1268	1281	N/A	INTRINSIC
low complexity region	1336	1376	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000102895

SMART Domains

Protein: ENSMUSP00000099959
Gene: ENSMUSG00000032125

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
IG	48	144	2.51e0	SMART
IGc2	160	225	6.86e-11	SMART
FN3	263	343	2.05e0	SMART
FN3	358	440	1.27e-3	SMART
low complexity region	488	494	N/A	INTRINSIC
low complexity region	544	562	N/A	INTRINSIC
low complexity region	720	733	N/A	INTRINSIC
low complexity region	748	762	N/A	INTRINSIC
low complexity region	775	799	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	871	880	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115038

SMART Domains

Protein: ENSMUSP00000110690
Gene: ENSMUSG00000032128

Domain	Start	End	E-Value	Type
low complexity region	34	47	N/A	INTRINSIC
IGc2	76	150	9.7e-11	SMART
IGc2	178	243	1.44e-4	SMART
IGc2	270	333	1.89e-13	SMART
IGc2	359	431	9.84e-12	SMART
IGc2	463	528	2.09e-15	SMART
FN3	556	638	4.24e-14	SMART
FN3	670	753	3.06e0	SMART
FN3	769	854	1.97e-9	SMART
low complexity region	892	912	N/A	INTRINSIC
low complexity region	1077	1104	N/A	INTRINSIC
low complexity region	1153	1171	N/A	INTRINSIC
low complexity region	1177	1191	N/A	INTRINSIC
low complexity region	1215	1228	N/A	INTRINSIC
low complexity region	1267	1278	N/A	INTRINSIC
low complexity region	1290	1303	N/A	INTRINSIC
low complexity region	1358	1398	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000115046

SMART Domains

Protein: ENSMUSP00000110698
Gene: ENSMUSG00000032125

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
IG	48	144	2.51e0	SMART
IGc2	160	225	6.86e-11	SMART
FN3	263	343	2.05e0	SMART
FN3	358	440	1.27e-3	SMART
low complexity region	484	500	N/A	INTRINSIC
low complexity region	540	546	N/A	INTRINSIC
low complexity region	596	614	N/A	INTRINSIC
low complexity region	747	756	N/A	INTRINSIC
low complexity region	779	792	N/A	INTRINSIC
low complexity region	807	821	N/A	INTRINSIC
low complexity region	834	858	N/A	INTRINSIC
low complexity region	914	925	N/A	INTRINSIC
low complexity region	930	939	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000115048

SMART Domains

Protein: ENSMUSP00000110700
Gene: ENSMUSG00000032125

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
IG	48	144	2.51e0	SMART
IGc2	160	225	6.86e-11	SMART
FN3	263	343	2.05e0	SMART
FN3	358	440	1.27e-3	SMART
low complexity region	488	494	N/A	INTRINSIC
low complexity region	544	562	N/A	INTRINSIC
low complexity region	695	704	N/A	INTRINSIC
low complexity region	727	740	N/A	INTRINSIC
low complexity region	755	769	N/A	INTRINSIC
low complexity region	782	806	N/A	INTRINSIC
low complexity region	862	873	N/A	INTRINSIC
low complexity region	878	887	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000156972

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167089

Predicted Effect

probably benign
Transcript: ENSMUST00000170512

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171467

Predicted Effect

probably null
Transcript: ENSMUST00000214185

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215777

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

99% (73/74)

MGI Phenotype

PHENOTYPE: Mice homozygous for a reporter/null allele display enhanced VEGF-induced endothelial migration, tube formation and vascular permeability, and show increased pathologic angiogenesis and vascular leak in models of oxygen-induced retinopathy and choroidal neovascularization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca17	C	A	17: 24,289,414	G1049V	probably damaging	Het
Afdn	G	A	17: 13,888,952	R1579H	probably damaging	Het
Ankrd28	T	A	14: 31,735,006	N386Y	probably damaging	Het
Atf7ip	T	A	6: 136,603,379	Y1100*	probably null	Het
Atp9b	T	A	18: 80,912,858	E3V	probably damaging	Het
AW554918	T	G	18: 25,175,431	D60E	possibly damaging	Het
Baz2b	G	T	2: 59,932,152	Q927K	probably damaging	Het
Birc6	A	G	17: 74,650,047	R3659G	probably damaging	Het
C8a	T	G	4: 104,845,988	N291H	probably damaging	Het
Calcoco1	G	A	15: 102,710,985	L390F	probably damaging	Het
Carmil3	A	G	14: 55,501,571	D894G	probably damaging	Het
Cdc20	A	G	4: 118,433,514	Y430H	probably damaging	Het
Cdc6	A	T	11: 98,912,262	I316F	probably damaging	Het
Cenpu	T	A	8: 46,578,910		probably null	Het
Csmd2	T	A	4: 128,456,914	V1592D	probably benign	Het
Csmd3	G	T	15: 48,791,944		probably null	Het
Dnah7c	T	C	1: 46,519,269	F512L	probably benign	Het
Fam136a	T	A	6: 86,366,704	L61Q	probably damaging	Het
Fpgs	A	C	2: 32,692,767		probably benign	Het
Fzd4	G	A	7: 89,407,673	M309I	probably benign	Het
Gad2	A	G	2: 22,673,957	T391A	probably benign	Het
Gm11563	A	T	11: 99,658,713	S72T	unknown	Het
Gm5155	T	A	7: 17,873,289		noncoding transcript	Het
Gon4l	A	G	3: 88,887,637	I716V	probably benign	Het
Itga9	T	C	9: 118,628,205	V128A	probably damaging	Het
Kat6a	CGCAGCAGCAGCAGCAGCA	CGCAGCAGCAGCA	8: 22,939,648		probably benign	Het
Lrrc9	T	A	12: 72,495,594	D1063E	possibly damaging	Het
Lyst	T	A	13: 13,648,802	L1453*	probably null	Het
Mcm3ap	T	C	10: 76,507,539	V1755A	probably damaging	Het
Mrc1	T	C	2: 14,310,058	S985P	probably damaging	Het
Mst1	A	C	9: 108,082,215	K233N	probably damaging	Het
Nr2c2ap	G	A	8: 70,132,003	D42N	probably damaging	Het
Ntn1	A	G	11: 68,385,712	S137P	probably benign	Het
Pard3	T	C	8: 127,460,386		probably null	Het
Pcdh15	T	A	10: 74,594,183	D1210E	probably damaging	Het
Pcdhga5	T	C	18: 37,694,721	L74P	probably benign	Het
Pcsk5	T	C	19: 17,595,658		probably null	Het
Pdia3	T	C	2: 121,414,003		probably benign	Het
Pikfyve	A	T	1: 65,196,699	R177*	probably null	Het
Pklr	A	G	3: 89,143,259	E409G	probably damaging	Het
Plod2	T	C	9: 92,581,323	Y154H	probably damaging	Het
Psmc3	T	A	2: 91,054,322	D6E	probably benign	Het
Ptpru	T	A	4: 131,820,023	N205I	possibly damaging	Het
Rbm6	T	C	9: 107,778,014	E1006G	probably benign	Het
Rgl2	T	C	17: 33,935,948	V642A	probably benign	Het
Rnf8	T	A	17: 29,626,706	H104Q	possibly damaging	Het
Rpa1	T	C	11: 75,313,344	N269S	probably damaging	Het
Sdk2	A	G	11: 113,867,031	M519T	probably benign	Het
Snx30	A	G	4: 59,885,070	S237G	probably benign	Het
Spx	A	G	6: 142,414,040	N36S	probably damaging	Het
Stard7	T	C	2: 127,295,496	Y289H	probably damaging	Het
Sugp2	T	C	8: 70,257,107		probably benign	Het
Susd4	C	T	1: 182,887,478	T288I	probably damaging	Het
Tceanc2	T	A	4: 107,177,629		probably null	Het
Tm4sf4	T	G	3: 57,433,738	V97G	probably benign	Het
Tmtc1	C	T	6: 148,355,131		probably benign	Het
Trappc11	C	T	8: 47,505,304		probably benign	Het
Triobp	G	T	15: 78,994,391	V398F	possibly damaging	Het
Ttll9	T	A	2: 152,962,544	S2T	possibly damaging	Het
Ttn	T	C	2: 76,900,976		probably benign	Het
Tyw3	A	G	3: 154,594,471	C80R	probably damaging	Het
Usp24	T	C	4: 106,385,424	V1177A	possibly damaging	Het
Vmn1r65	A	G	7: 6,008,755	V160A	probably damaging	Het
Vmn2r104	T	A	17: 20,041,884	H328L	probably benign	Het
Vmn2r65	A	C	7: 84,940,641	I689S	probably damaging	Het
Wrn	A	G	8: 33,241,101	Y1068H	probably damaging	Het
Xpo4	C	A	14: 57,613,409	S346I	probably benign	Het
Zc3h3	T	A	15: 75,839,590	T341S	probably benign	Het
Zxdc	T	C	6: 90,370,437	M260T	possibly damaging	Het

Other mutations in Robo4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Robo4	APN	9	37411104	missense	probably damaging	1.00
IGL00392:Robo4	APN	9	37408229	missense	probably damaging	1.00
IGL00491:Robo4	APN	9	37405935	missense	possibly damaging	0.52
IGL00792:Robo4	APN	9	37408211	missense	probably damaging	1.00
IGL01062:Robo4	APN	9	37406000	missense	probably benign	0.08
IGL01287:Robo4	APN	9	37413040	missense	possibly damaging	0.96
IGL02289:Robo4	APN	9	37408200	missense	probably damaging	1.00
IGL02486:Robo4	APN	9	37408374	missense	probably damaging	1.00
IGL02851:Robo4	APN	9	37413382	missense	probably damaging	0.96
IGL02898:Robo4	APN	9	37408176	missense	probably damaging	0.99
IGL02965:Robo4	APN	9	37410469	missense	possibly damaging	0.82
IGL03071:Robo4	APN	9	37404284	splice site	probably benign
IGL03102:Robo4	APN	9	37404185	missense	probably damaging	1.00
H8562:Robo4	UTSW	9	37405810	intron	probably benign
PIT4305001:Robo4	UTSW	9	37411391	missense	probably damaging	1.00
R0056:Robo4	UTSW	9	37404477	missense	probably benign	0.03
R0068:Robo4	UTSW	9	37404477	missense	probably benign	0.03
R0233:Robo4	UTSW	9	37402681	missense	probably damaging	1.00
R0233:Robo4	UTSW	9	37402681	missense	probably damaging	1.00
R0416:Robo4	UTSW	9	37404766	splice site	probably benign
R1005:Robo4	UTSW	9	37408251	missense	probably damaging	1.00
R1174:Robo4	UTSW	9	37413052	missense	probably damaging	1.00
R1183:Robo4	UTSW	9	37408052	missense	probably damaging	1.00
R1254:Robo4	UTSW	9	37410840	critical splice donor site	probably null
R1398:Robo4	UTSW	9	37408076	critical splice donor site	probably null
R1505:Robo4	UTSW	9	37403227	missense	probably damaging	0.98
R1701:Robo4	UTSW	9	37403443	missense	probably benign	0.44
R1834:Robo4	UTSW	9	37413059	missense	probably benign	0.09
R1899:Robo4	UTSW	9	37404070	splice site	probably benign
R2203:Robo4	UTSW	9	37411490	frame shift	probably null
R2204:Robo4	UTSW	9	37411490	frame shift	probably null
R2351:Robo4	UTSW	9	37411660	missense	probably benign	0.01
R2448:Robo4	UTSW	9	37402662	missense	possibly damaging	0.96
R2847:Robo4	UTSW	9	37404476	nonsense	probably null
R2851:Robo4	UTSW	9	37411490	frame shift	probably null
R2852:Robo4	UTSW	9	37411490	frame shift	probably null
R2877:Robo4	UTSW	9	37411490	frame shift	probably null
R3123:Robo4	UTSW	9	37411490	frame shift	probably null
R3124:Robo4	UTSW	9	37411490	frame shift	probably null
R3125:Robo4	UTSW	9	37411490	frame shift	probably null
R3805:Robo4	UTSW	9	37404438	missense	possibly damaging	0.73
R3806:Robo4	UTSW	9	37404438	missense	possibly damaging	0.73
R3892:Robo4	UTSW	9	37411490	frame shift	probably null
R3905:Robo4	UTSW	9	37403505	nonsense	probably null
R3938:Robo4	UTSW	9	37402017	start gained	probably benign
R4261:Robo4	UTSW	9	37405581	missense	probably benign	0.04
R4434:Robo4	UTSW	9	37411490	frame shift	probably null
R4435:Robo4	UTSW	9	37411490	frame shift	probably null
R4561:Robo4	UTSW	9	37411490	frame shift	probably null
R4562:Robo4	UTSW	9	37411490	frame shift	probably null
R4568:Robo4	UTSW	9	37404822	missense	possibly damaging	0.59
R4695:Robo4	UTSW	9	37403199	missense	probably damaging	1.00
R4921:Robo4	UTSW	9	37402560	missense	probably benign
R5000:Robo4	UTSW	9	37408368	missense	probably benign	0.02
R5056:Robo4	UTSW	9	37404806	missense	probably benign	0.00
R5125:Robo4	UTSW	9	37407960	missense	probably damaging	1.00
R5178:Robo4	UTSW	9	37407960	missense	probably damaging	1.00
R5278:Robo4	UTSW	9	37411490	frame shift	probably null
R5285:Robo4	UTSW	9	37411490	frame shift	probably null
R5347:Robo4	UTSW	9	37411490	frame shift	probably null
R5348:Robo4	UTSW	9	37411490	frame shift	probably null
R5361:Robo4	UTSW	9	37413378	missense	probably benign	0.01
R5403:Robo4	UTSW	9	37411490	frame shift	probably null
R5404:Robo4	UTSW	9	37411490	frame shift	probably null
R5488:Robo4	UTSW	9	37411490	frame shift	probably null
R5489:Robo4	UTSW	9	37411490	frame shift	probably null
R5490:Robo4	UTSW	9	37411490	frame shift	probably null
R5494:Robo4	UTSW	9	37411490	frame shift	probably null
R5629:Robo4	UTSW	9	37408362	missense	probably damaging	1.00
R5736:Robo4	UTSW	9	37404797	missense	possibly damaging	0.63
R5796:Robo4	UTSW	9	37411674	missense	probably benign	0.00
R5987:Robo4	UTSW	9	37411400	missense	probably damaging	1.00
R6178:Robo4	UTSW	9	37405630	nonsense	probably null
R6189:Robo4	UTSW	9	37403533	missense	probably benign	0.35
R6365:Robo4	UTSW	9	37410712	missense	probably benign	0.34
R6528:Robo4	UTSW	9	37404368	missense	possibly damaging	0.92
R6887:Robo4	UTSW	9	37402067	missense	possibly damaging	0.82
R7196:Robo4	UTSW	9	37402705	missense	possibly damaging	0.92
R7408:Robo4	UTSW	9	37410981	missense	probably benign	0.09
R7419:Robo4	UTSW	9	37402809	missense	probably benign	0.18
R7486:Robo4	UTSW	9	37405574	missense	probably damaging	0.99
R7707:Robo4	UTSW	9	37413122	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGTGCCCTAACCAGTGTC -3'
(R):5'- TGAAGACACAGTCAGCTTCC -3'

Sequencing Primer
(F):5'- GTGCCCTAACCAGTGTCCTGTC -3'
(R):5'- ACAGTCAGCTTCCCTGGGATC -3'

Posted On

2016-07-22