Incidental Mutation 'R5279:Plod2'
ID404119
Institutional Source Beutler Lab
Gene Symbol Plod2
Ensembl Gene ENSMUSG00000032374
Gene Nameprocollagen lysine, 2-oxoglutarate 5-dioxygenase 2
SynonymsD530025C14Rik, Plod-2, LH2, lysyl hydroxylase 2
MMRRC Submission 042839-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5279 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location92542223-92608428 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92581323 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 154 (Y154H)
Ref Sequence ENSEMBL: ENSMUSP00000068611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070522] [ENSMUST00000160359]
Predicted Effect probably damaging
Transcript: ENSMUST00000070522
AA Change: Y154H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000068611
Gene: ENSMUSG00000032374
AA Change: Y154H

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 181 193 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Blast:P4Hc 453 500 1e-22 BLAST
P4Hc 563 736 6.38e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160142
Predicted Effect probably damaging
Transcript: ENSMUST00000160359
AA Change: Y154H

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125373
Gene: ENSMUSG00000032374
AA Change: Y154H

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 181 193 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Blast:P4Hc 453 500 1e-22 BLAST
P4Hc 584 757 6.38e-21 SMART
Meta Mutation Damage Score 0.5370 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound homodimeric enzyme that is localized to the cisternae of the rough endoplasmic reticulum. The enzyme (cofactors iron and ascorbate) catalyzes the hydroxylation of lysyl residues in collagen-like peptides. The resultant hydroxylysyl groups are attachment sites for carbohydrates in collagen and thus are critical for the stability of intermolecular crosslinks. Some patients with Ehlers-Danlos syndrome type VIB have deficiencies in lysyl hydroxylase activity. Mutations in the coding region of this gene are associated with Bruck syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 C A 17: 24,289,414 G1049V probably damaging Het
Afdn G A 17: 13,888,952 R1579H probably damaging Het
Ankrd28 T A 14: 31,735,006 N386Y probably damaging Het
Atf7ip T A 6: 136,603,379 Y1100* probably null Het
Atp9b T A 18: 80,912,858 E3V probably damaging Het
AW554918 T G 18: 25,175,431 D60E possibly damaging Het
Baz2b G T 2: 59,932,152 Q927K probably damaging Het
Birc6 A G 17: 74,650,047 R3659G probably damaging Het
C8a T G 4: 104,845,988 N291H probably damaging Het
Calcoco1 G A 15: 102,710,985 L390F probably damaging Het
Carmil3 A G 14: 55,501,571 D894G probably damaging Het
Cdc20 A G 4: 118,433,514 Y430H probably damaging Het
Cdc6 A T 11: 98,912,262 I316F probably damaging Het
Cenpu T A 8: 46,578,910 probably null Het
Csmd2 T A 4: 128,456,914 V1592D probably benign Het
Csmd3 G T 15: 48,791,944 probably null Het
Dnah7c T C 1: 46,519,269 F512L probably benign Het
Fam136a T A 6: 86,366,704 L61Q probably damaging Het
Fpgs A C 2: 32,692,767 probably benign Het
Fzd4 G A 7: 89,407,673 M309I probably benign Het
Gad2 A G 2: 22,673,957 T391A probably benign Het
Gm11563 A T 11: 99,658,713 S72T unknown Het
Gm5155 T A 7: 17,873,289 noncoding transcript Het
Gon4l A G 3: 88,887,637 I716V probably benign Het
Itga9 T C 9: 118,628,205 V128A probably damaging Het
Kat6a CGCAGCAGCAGCAGCAGCA CGCAGCAGCAGCA 8: 22,939,648 probably benign Het
Lrrc9 T A 12: 72,495,594 D1063E possibly damaging Het
Lyst T A 13: 13,648,802 L1453* probably null Het
Mcm3ap T C 10: 76,507,539 V1755A probably damaging Het
Mrc1 T C 2: 14,310,058 S985P probably damaging Het
Mst1 A C 9: 108,082,215 K233N probably damaging Het
Nr2c2ap G A 8: 70,132,003 D42N probably damaging Het
Ntn1 A G 11: 68,385,712 S137P probably benign Het
Pard3 T C 8: 127,460,386 probably null Het
Pcdh15 T A 10: 74,594,183 D1210E probably damaging Het
Pcdhga5 T C 18: 37,694,721 L74P probably benign Het
Pcsk5 T C 19: 17,595,658 probably null Het
Pdia3 T C 2: 121,414,003 probably benign Het
Pikfyve A T 1: 65,196,699 R177* probably null Het
Pklr A G 3: 89,143,259 E409G probably damaging Het
Psmc3 T A 2: 91,054,322 D6E probably benign Het
Ptpru T A 4: 131,820,023 N205I possibly damaging Het
Rbm6 T C 9: 107,778,014 E1006G probably benign Het
Rgl2 T C 17: 33,935,948 V642A probably benign Het
Rnf8 T A 17: 29,626,706 H104Q possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Rpa1 T C 11: 75,313,344 N269S probably damaging Het
Sdk2 A G 11: 113,867,031 M519T probably benign Het
Snx30 A G 4: 59,885,070 S237G probably benign Het
Spx A G 6: 142,414,040 N36S probably damaging Het
Stard7 T C 2: 127,295,496 Y289H probably damaging Het
Sugp2 T C 8: 70,257,107 probably benign Het
Susd4 C T 1: 182,887,478 T288I probably damaging Het
Tceanc2 T A 4: 107,177,629 probably null Het
Tm4sf4 T G 3: 57,433,738 V97G probably benign Het
Tmtc1 C T 6: 148,355,131 probably benign Het
Trappc11 C T 8: 47,505,304 probably benign Het
Triobp G T 15: 78,994,391 V398F possibly damaging Het
Ttll9 T A 2: 152,962,544 S2T possibly damaging Het
Ttn T C 2: 76,900,976 probably benign Het
Tyw3 A G 3: 154,594,471 C80R probably damaging Het
Usp24 T C 4: 106,385,424 V1177A possibly damaging Het
Vmn1r65 A G 7: 6,008,755 V160A probably damaging Het
Vmn2r104 T A 17: 20,041,884 H328L probably benign Het
Vmn2r65 A C 7: 84,940,641 I689S probably damaging Het
Wrn A G 8: 33,241,101 Y1068H probably damaging Het
Xpo4 C A 14: 57,613,409 S346I probably benign Het
Zc3h3 T A 15: 75,839,590 T341S probably benign Het
Zxdc T C 6: 90,370,437 M260T possibly damaging Het
Other mutations in Plod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Plod2 APN 9 92598614 missense probably damaging 0.99
IGL00945:Plod2 APN 9 92584496 missense probably benign 0.08
IGL01386:Plod2 APN 9 92606602 missense probably damaging 0.99
IGL01519:Plod2 APN 9 92595295 missense probably benign 0.00
IGL01836:Plod2 APN 9 92606498 splice site probably benign
IGL02490:Plod2 APN 9 92586842 missense probably benign 0.00
IGL02496:Plod2 APN 9 92607094 missense probably damaging 1.00
IGL02699:Plod2 APN 9 92607142 missense probably damaging 1.00
IGL02735:Plod2 APN 9 92595389 splice site probably benign
IGL03106:Plod2 APN 9 92573567 missense probably damaging 0.98
R0270:Plod2 UTSW 9 92584521 missense probably benign 0.10
R0546:Plod2 UTSW 9 92595335 missense probably damaging 1.00
R0589:Plod2 UTSW 9 92593746 missense probably benign
R0707:Plod2 UTSW 9 92605427 missense possibly damaging 0.91
R1491:Plod2 UTSW 9 92606584 missense probably benign 0.00
R1572:Plod2 UTSW 9 92603067 splice site probably benign
R1731:Plod2 UTSW 9 92584604 critical splice donor site probably null
R1895:Plod2 UTSW 9 92607135 missense probably damaging 1.00
R1917:Plod2 UTSW 9 92581257 missense probably benign
R1946:Plod2 UTSW 9 92607135 missense probably damaging 1.00
R3850:Plod2 UTSW 9 92542545 missense probably benign 0.28
R3973:Plod2 UTSW 9 92598619 nonsense probably null
R3974:Plod2 UTSW 9 92598619 nonsense probably null
R4289:Plod2 UTSW 9 92602988 missense possibly damaging 0.89
R4423:Plod2 UTSW 9 92601989 missense probably benign 0.00
R4647:Plod2 UTSW 9 92605450 nonsense probably null
R4754:Plod2 UTSW 9 92606531 nonsense probably null
R4769:Plod2 UTSW 9 92595272 missense probably damaging 1.00
R5535:Plod2 UTSW 9 92606569 missense probably damaging 1.00
R5654:Plod2 UTSW 9 92593823 missense probably benign
R5764:Plod2 UTSW 9 92603021 missense probably damaging 0.97
R5885:Plod2 UTSW 9 92606656 critical splice donor site probably null
R5940:Plod2 UTSW 9 92591397 missense probably benign 0.39
R6917:Plod2 UTSW 9 92593770 missense possibly damaging 0.87
R7109:Plod2 UTSW 9 92573597 missense probably damaging 1.00
R7221:Plod2 UTSW 9 92584527 missense probably damaging 1.00
R7311:Plod2 UTSW 9 92584558 missense probably damaging 1.00
Z1088:Plod2 UTSW 9 92603035 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAATGTAGTTCCTGTGATGTGAG -3'
(R):5'- TGCCTAGATACACAGGTAGTCC -3'

Sequencing Primer
(F):5'- GGTTGCCTGCTGTGTTCTCTAAAC -3'
(R):5'- TCCAAGGGAAATGGTTTTCAAGC -3'
Posted On2016-07-22