Incidental Mutation 'R5279:Ntn1'
ID 404125
Institutional Source Beutler Lab
Gene Symbol Ntn1
Ensembl Gene ENSMUSG00000020902
Gene Name netrin 1
Synonyms Netrin-1
MMRRC Submission 042839-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.735) question?
Stock # R5279 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 68209364-68400823 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 68385712 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 137 (S137P)
Ref Sequence ENSEMBL: ENSMUSP00000121193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021284] [ENSMUST00000108674] [ENSMUST00000135141]
AlphaFold O09118
Predicted Effect probably benign
Transcript: ENSMUST00000021284
AA Change: S137P

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000021284
Gene: ENSMUSG00000020902
AA Change: S137P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 283 7.14e-148 SMART
EGF_Lam 285 338 2.44e-9 SMART
EGF_Lam 341 401 3.01e-9 SMART
EGF_Lam 404 451 8.43e-13 SMART
C345C 487 595 1.67e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108674
AA Change: S137P

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104314
Gene: ENSMUSG00000020902
AA Change: S137P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 283 7.14e-148 SMART
EGF_Lam 285 338 2.44e-9 SMART
EGF_Lam 341 401 3.01e-9 SMART
EGF_Lam 404 451 8.43e-13 SMART
C345C 487 595 1.67e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135141
AA Change: S137P

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000121193
Gene: ENSMUSG00000020902
AA Change: S137P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 159 6.8e-15 SMART
Meta Mutation Damage Score 0.1901 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Netrin is included in a family of laminin-related secreted proteins. The function of this gene has not yet been defined; however, netrin is thought to be involved in axon guidance and cell migration during development. Mutations and loss of expression of netrin suggest that variation in netrin may be involved in cancer development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit impaired axonal migration, abnormal semicircular canals, lack of corpus callosum, aberrant commissures, hypoplasia of the optic nerve, motor and balance defects, failure to suckle, and neonatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 C A 17: 24,289,414 (GRCm38) G1049V probably damaging Het
Afdn G A 17: 13,888,952 (GRCm38) R1579H probably damaging Het
Ankrd28 T A 14: 31,735,006 (GRCm38) N386Y probably damaging Het
Atf7ip T A 6: 136,603,379 (GRCm38) Y1100* probably null Het
Atp9b T A 18: 80,912,858 (GRCm38) E3V probably damaging Het
AW554918 T G 18: 25,175,431 (GRCm38) D60E possibly damaging Het
Baz2b G T 2: 59,932,152 (GRCm38) Q927K probably damaging Het
Birc6 A G 17: 74,650,047 (GRCm38) R3659G probably damaging Het
C8a T G 4: 104,845,988 (GRCm38) N291H probably damaging Het
Calcoco1 G A 15: 102,710,985 (GRCm38) L390F probably damaging Het
Carmil3 A G 14: 55,501,571 (GRCm38) D894G probably damaging Het
Cdc20 A G 4: 118,433,514 (GRCm38) Y430H probably damaging Het
Cdc6 A T 11: 98,912,262 (GRCm38) I316F probably damaging Het
Ceacam23 T A 7: 17,873,289 (GRCm38) noncoding transcript Het
Cenpu T A 8: 46,578,910 (GRCm38) probably null Het
Csmd2 T A 4: 128,456,914 (GRCm38) V1592D probably benign Het
Csmd3 G T 15: 48,791,944 (GRCm38) probably null Het
Dnah7c T C 1: 46,519,269 (GRCm38) F512L probably benign Het
Fam136a T A 6: 86,366,704 (GRCm38) L61Q probably damaging Het
Fpgs A C 2: 32,692,767 (GRCm38) probably benign Het
Fzd4 G A 7: 89,407,673 (GRCm38) M309I probably benign Het
Gad2 A G 2: 22,673,957 (GRCm38) T391A probably benign Het
Gm11563 A T 11: 99,658,713 (GRCm38) S72T unknown Het
Gon4l A G 3: 88,887,637 (GRCm38) I716V probably benign Het
Itga9 T C 9: 118,628,205 (GRCm38) V128A probably damaging Het
Kat6a CGCAGCAGCAGCAGCAGCA CGCAGCAGCAGCA 8: 22,939,648 (GRCm38) probably benign Het
Lrrc9 T A 12: 72,495,594 (GRCm38) D1063E possibly damaging Het
Lyst T A 13: 13,648,802 (GRCm38) L1453* probably null Het
Mcm3ap T C 10: 76,507,539 (GRCm38) V1755A probably damaging Het
Mrc1 T C 2: 14,310,058 (GRCm38) S985P probably damaging Het
Mst1 A C 9: 108,082,215 (GRCm38) K233N probably damaging Het
Nr2c2ap G A 8: 70,132,003 (GRCm38) D42N probably damaging Het
Pard3 T C 8: 127,460,386 (GRCm38) probably null Het
Pcdh15 T A 10: 74,594,183 (GRCm38) D1210E probably damaging Het
Pcdhga5 T C 18: 37,694,721 (GRCm38) L74P probably benign Het
Pcsk5 T C 19: 17,595,658 (GRCm38) probably null Het
Pdia3 T C 2: 121,414,003 (GRCm38) probably benign Het
Pikfyve A T 1: 65,196,699 (GRCm38) R177* probably null Het
Pklr A G 3: 89,143,259 (GRCm38) E409G probably damaging Het
Plod2 T C 9: 92,581,323 (GRCm38) Y154H probably damaging Het
Psmc3 T A 2: 91,054,322 (GRCm38) D6E probably benign Het
Ptpru T A 4: 131,820,023 (GRCm38) N205I possibly damaging Het
Rbm6 T C 9: 107,778,014 (GRCm38) E1006G probably benign Het
Rgl2 T C 17: 33,935,948 (GRCm38) V642A probably benign Het
Rnf8 T A 17: 29,626,706 (GRCm38) H104Q possibly damaging Het
Robo4 CGG CG 9: 37,411,490 (GRCm38) probably null Het
Rpa1 T C 11: 75,313,344 (GRCm38) N269S probably damaging Het
Sdk2 A G 11: 113,867,031 (GRCm38) M519T probably benign Het
Snx30 A G 4: 59,885,070 (GRCm38) S237G probably benign Het
Spx A G 6: 142,414,040 (GRCm38) N36S probably damaging Het
Stard7 T C 2: 127,295,496 (GRCm38) Y289H probably damaging Het
Sugp2 T C 8: 70,257,107 (GRCm38) probably benign Het
Susd4 C T 1: 182,887,478 (GRCm38) T288I probably damaging Het
Tceanc2 T A 4: 107,177,629 (GRCm38) probably null Het
Tm4sf4 T G 3: 57,433,738 (GRCm38) V97G probably benign Het
Tmtc1 C T 6: 148,355,131 (GRCm38) probably benign Het
Trappc11 C T 8: 47,505,304 (GRCm38) probably benign Het
Triobp G T 15: 78,994,391 (GRCm38) V398F possibly damaging Het
Ttll9 T A 2: 152,962,544 (GRCm38) S2T possibly damaging Het
Ttn T C 2: 76,900,976 (GRCm38) probably benign Het
Tyw3 A G 3: 154,594,471 (GRCm38) C80R probably damaging Het
Usp24 T C 4: 106,385,424 (GRCm38) V1177A possibly damaging Het
Vmn1r65 A G 7: 6,008,755 (GRCm38) V160A probably damaging Het
Vmn2r104 T A 17: 20,041,884 (GRCm38) H328L probably benign Het
Vmn2r65 A C 7: 84,940,641 (GRCm38) I689S probably damaging Het
Wrn A G 8: 33,241,101 (GRCm38) Y1068H probably damaging Het
Xpo4 C A 14: 57,613,409 (GRCm38) S346I probably benign Het
Zc3h3 T A 15: 75,839,590 (GRCm38) T341S probably benign Het
Zxdc T C 6: 90,370,437 (GRCm38) M260T possibly damaging Het
Other mutations in Ntn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ntn1 APN 11 68,226,619 (GRCm38) splice site probably benign
IGL00972:Ntn1 APN 11 68,213,272 (GRCm38) missense possibly damaging 0.83
IGL01695:Ntn1 APN 11 68,226,604 (GRCm38) missense probably benign 0.00
IGL01731:Ntn1 APN 11 68,385,418 (GRCm38) missense probably damaging 1.00
IGL02008:Ntn1 APN 11 68,213,263 (GRCm38) missense probably damaging 1.00
IGL02584:Ntn1 APN 11 68,277,530 (GRCm38) missense probably damaging 1.00
IGL02664:Ntn1 APN 11 68,385,469 (GRCm38) missense probably benign 0.06
R0363:Ntn1 UTSW 11 68,385,543 (GRCm38) missense probably benign 0.44
R1201:Ntn1 UTSW 11 68,213,226 (GRCm38) missense probably damaging 0.96
R1268:Ntn1 UTSW 11 68,213,133 (GRCm38) small deletion probably benign
R1913:Ntn1 UTSW 11 68,213,185 (GRCm38) missense probably damaging 1.00
R2245:Ntn1 UTSW 11 68,385,294 (GRCm38) missense probably benign 0.12
R2248:Ntn1 UTSW 11 68,277,572 (GRCm38) missense possibly damaging 0.95
R2359:Ntn1 UTSW 11 68,385,612 (GRCm38) missense probably damaging 1.00
R2862:Ntn1 UTSW 11 68,385,864 (GRCm38) missense probably benign 0.00
R3830:Ntn1 UTSW 11 68,385,793 (GRCm38) missense probably damaging 1.00
R3851:Ntn1 UTSW 11 68,385,793 (GRCm38) missense probably damaging 1.00
R3852:Ntn1 UTSW 11 68,385,793 (GRCm38) missense probably damaging 1.00
R4413:Ntn1 UTSW 11 68,385,910 (GRCm38) missense probably damaging 1.00
R4870:Ntn1 UTSW 11 68,213,026 (GRCm38) small deletion probably benign
R4871:Ntn1 UTSW 11 68,213,026 (GRCm38) small deletion probably benign
R4952:Ntn1 UTSW 11 68,213,026 (GRCm38) small deletion probably benign
R5001:Ntn1 UTSW 11 68,260,532 (GRCm38) missense probably damaging 1.00
R6217:Ntn1 UTSW 11 68,213,332 (GRCm38) missense possibly damaging 0.91
R6505:Ntn1 UTSW 11 68,213,199 (GRCm38) missense probably damaging 1.00
R6669:Ntn1 UTSW 11 68,385,750 (GRCm38) missense probably benign 0.00
R7172:Ntn1 UTSW 11 68,385,667 (GRCm38) missense probably damaging 1.00
R7411:Ntn1 UTSW 11 68,386,089 (GRCm38) missense probably benign 0.15
R8314:Ntn1 UTSW 11 68,385,624 (GRCm38) missense probably damaging 1.00
R9216:Ntn1 UTSW 11 68,226,571 (GRCm38) missense possibly damaging 0.76
R9385:Ntn1 UTSW 11 68,385,187 (GRCm38) missense probably damaging 1.00
R9442:Ntn1 UTSW 11 68,257,659 (GRCm38) intron probably benign
R9697:Ntn1 UTSW 11 68,277,530 (GRCm38) missense probably damaging 1.00
R9752:Ntn1 UTSW 11 68,385,886 (GRCm38) missense possibly damaging 0.80
X0027:Ntn1 UTSW 11 68,385,636 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGTAATAGGAGTCGCGCG -3'
(R):5'- ACTTTGTCAACGCGGCCTTC -3'

Sequencing Primer
(F):5'- TGAAAGCCACGCGGATGTC -3'
(R):5'- CTACTGCGTGGTGAGCGAG -3'
Posted On 2016-07-22