Mutagenetix > Incidental Mutation

Incidental Mutation 'R5279:Vmn2r104'

404142

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r104

Ensembl Gene

ENSMUSG00000090315

Gene Name

vomeronasal 2, receptor 104

Synonyms

V2r7

MMRRC Submission

042839-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.124) question?

Stock #

R5279 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20029425-20048205 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 20041884 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 328 (H328L)

Ref Sequence

ENSEMBL: ENSMUSP00000129895 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168050]

AlphaFold

E9Q2J5

Predicted Effect

probably benign
Transcript: ENSMUST00000168050
AA Change: H328L

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000129895
Gene: ENSMUSG00000090315
AA Change: H328L

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	85	457	4e-38	PFAM
Pfam:NCD3G	512	565	2.1e-20	PFAM
Pfam:7tm_3	598	833	1.7e-52	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

99% (73/74)

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca17	C	A	17: 24,289,414	G1049V	probably damaging	Het
Afdn	G	A	17: 13,888,952	R1579H	probably damaging	Het
Ankrd28	T	A	14: 31,735,006	N386Y	probably damaging	Het
Atf7ip	T	A	6: 136,603,379	Y1100*	probably null	Het
Atp9b	T	A	18: 80,912,858	E3V	probably damaging	Het
AW554918	T	G	18: 25,175,431	D60E	possibly damaging	Het
Baz2b	G	T	2: 59,932,152	Q927K	probably damaging	Het
Birc6	A	G	17: 74,650,047	R3659G	probably damaging	Het
C8a	T	G	4: 104,845,988	N291H	probably damaging	Het
Calcoco1	G	A	15: 102,710,985	L390F	probably damaging	Het
Carmil3	A	G	14: 55,501,571	D894G	probably damaging	Het
Cdc20	A	G	4: 118,433,514	Y430H	probably damaging	Het
Cdc6	A	T	11: 98,912,262	I316F	probably damaging	Het
Cenpu	T	A	8: 46,578,910		probably null	Het
Csmd2	T	A	4: 128,456,914	V1592D	probably benign	Het
Csmd3	G	T	15: 48,791,944		probably null	Het
Dnah7c	T	C	1: 46,519,269	F512L	probably benign	Het
Fam136a	T	A	6: 86,366,704	L61Q	probably damaging	Het
Fpgs	A	C	2: 32,692,767		probably benign	Het
Fzd4	G	A	7: 89,407,673	M309I	probably benign	Het
Gad2	A	G	2: 22,673,957	T391A	probably benign	Het
Gm11563	A	T	11: 99,658,713	S72T	unknown	Het
Gm5155	T	A	7: 17,873,289		noncoding transcript	Het
Gon4l	A	G	3: 88,887,637	I716V	probably benign	Het
Itga9	T	C	9: 118,628,205	V128A	probably damaging	Het
Kat6a	CGCAGCAGCAGCAGCAGCA	CGCAGCAGCAGCA	8: 22,939,648		probably benign	Het
Lrrc9	T	A	12: 72,495,594	D1063E	possibly damaging	Het
Lyst	T	A	13: 13,648,802	L1453*	probably null	Het
Mcm3ap	T	C	10: 76,507,539	V1755A	probably damaging	Het
Mrc1	T	C	2: 14,310,058	S985P	probably damaging	Het
Mst1	A	C	9: 108,082,215	K233N	probably damaging	Het
Nr2c2ap	G	A	8: 70,132,003	D42N	probably damaging	Het
Ntn1	A	G	11: 68,385,712	S137P	probably benign	Het
Pard3	T	C	8: 127,460,386		probably null	Het
Pcdh15	T	A	10: 74,594,183	D1210E	probably damaging	Het
Pcdhga5	T	C	18: 37,694,721	L74P	probably benign	Het
Pcsk5	T	C	19: 17,595,658		probably null	Het
Pdia3	T	C	2: 121,414,003		probably benign	Het
Pikfyve	A	T	1: 65,196,699	R177*	probably null	Het
Pklr	A	G	3: 89,143,259	E409G	probably damaging	Het
Plod2	T	C	9: 92,581,323	Y154H	probably damaging	Het
Psmc3	T	A	2: 91,054,322	D6E	probably benign	Het
Ptpru	T	A	4: 131,820,023	N205I	possibly damaging	Het
Rbm6	T	C	9: 107,778,014	E1006G	probably benign	Het
Rgl2	T	C	17: 33,935,948	V642A	probably benign	Het
Rnf8	T	A	17: 29,626,706	H104Q	possibly damaging	Het
Robo4	CGG	CG	9: 37,411,490		probably null	Het
Rpa1	T	C	11: 75,313,344	N269S	probably damaging	Het
Sdk2	A	G	11: 113,867,031	M519T	probably benign	Het
Snx30	A	G	4: 59,885,070	S237G	probably benign	Het
Spx	A	G	6: 142,414,040	N36S	probably damaging	Het
Stard7	T	C	2: 127,295,496	Y289H	probably damaging	Het
Sugp2	T	C	8: 70,257,107		probably benign	Het
Susd4	C	T	1: 182,887,478	T288I	probably damaging	Het
Tceanc2	T	A	4: 107,177,629		probably null	Het
Tm4sf4	T	G	3: 57,433,738	V97G	probably benign	Het
Tmtc1	C	T	6: 148,355,131		probably benign	Het
Trappc11	C	T	8: 47,505,304		probably benign	Het
Triobp	G	T	15: 78,994,391	V398F	possibly damaging	Het
Ttll9	T	A	2: 152,962,544	S2T	possibly damaging	Het
Ttn	T	C	2: 76,900,976		probably benign	Het
Tyw3	A	G	3: 154,594,471	C80R	probably damaging	Het
Usp24	T	C	4: 106,385,424	V1177A	possibly damaging	Het
Vmn1r65	A	G	7: 6,008,755	V160A	probably damaging	Het
Vmn2r65	A	C	7: 84,940,641	I689S	probably damaging	Het
Wrn	A	G	8: 33,241,101	Y1068H	probably damaging	Het
Xpo4	C	A	14: 57,613,409	S346I	probably benign	Het
Zc3h3	T	A	15: 75,839,590	T341S	probably benign	Het
Zxdc	T	C	6: 90,370,437	M260T	possibly damaging	Het

Other mutations in Vmn2r104

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Vmn2r104	APN	17	20038239	missense	probably damaging	0.98
IGL01098:Vmn2r104	APN	17	20048096	missense	probably benign	0.27
IGL01333:Vmn2r104	APN	17	20042793	missense	probably benign	0.17
IGL01527:Vmn2r104	APN	17	20042896	missense	possibly damaging	0.82
IGL01773:Vmn2r104	APN	17	20040668	missense	probably benign	0.10
IGL01939:Vmn2r104	APN	17	20029925	missense	probably damaging	0.99
IGL02121:Vmn2r104	APN	17	20041794	nonsense	probably null
IGL02305:Vmn2r104	APN	17	20042856	missense	probably benign	0.09
IGL02374:Vmn2r104	APN	17	20042786	missense	probably benign	0.34
IGL03260:Vmn2r104	APN	17	20042821	missense	probably benign	0.05
IGL03366:Vmn2r104	APN	17	20029604	missense	probably damaging	1.00
R0091:Vmn2r104	UTSW	17	20041813	missense	possibly damaging	0.79
R0125:Vmn2r104	UTSW	17	20029807	missense	probably damaging	0.98
R0257:Vmn2r104	UTSW	17	20029627	missense	probably damaging	1.00
R0381:Vmn2r104	UTSW	17	20048002	nonsense	probably null
R0709:Vmn2r104	UTSW	17	20042904	missense	probably damaging	1.00
R0786:Vmn2r104	UTSW	17	20042725	missense	probably benign
R1575:Vmn2r104	UTSW	17	20042215	missense	probably damaging	1.00
R1827:Vmn2r104	UTSW	17	20042235	missense	probably damaging	0.97
R1932:Vmn2r104	UTSW	17	20040769	missense	probably damaging	1.00
R1956:Vmn2r104	UTSW	17	20042051	missense	probably damaging	0.98
R2203:Vmn2r104	UTSW	17	20029821	missense	probably benign	0.05
R2205:Vmn2r104	UTSW	17	20029821	missense	probably benign	0.05
R2859:Vmn2r104	UTSW	17	20048193	missense	possibly damaging	0.82
R3701:Vmn2r104	UTSW	17	20029556	missense	probably damaging	1.00
R3834:Vmn2r104	UTSW	17	20029921	missense	probably benign	0.02
R4151:Vmn2r104	UTSW	17	20029885	missense	probably damaging	1.00
R4470:Vmn2r104	UTSW	17	20042241	missense	probably damaging	1.00
R4625:Vmn2r104	UTSW	17	20048181	missense	probably benign	0.00
R4754:Vmn2r104	UTSW	17	20040768	nonsense	probably null
R4911:Vmn2r104	UTSW	17	20030026	missense	probably benign	0.00
R5270:Vmn2r104	UTSW	17	20038266	missense	probably damaging	1.00
R5311:Vmn2r104	UTSW	17	20029901	missense	probably damaging	1.00
R5370:Vmn2r104	UTSW	17	20030188	missense	probably damaging	0.97
R5461:Vmn2r104	UTSW	17	20030081	missense	probably damaging	1.00
R5683:Vmn2r104	UTSW	17	20040719	nonsense	probably null
R5795:Vmn2r104	UTSW	17	20030110	missense	probably benign	0.02
R5795:Vmn2r104	UTSW	17	20030282	missense	possibly damaging	0.89
R5970:Vmn2r104	UTSW	17	20029471	missense	probably benign	0.01
R5983:Vmn2r104	UTSW	17	20041708	missense	probably damaging	1.00
R5992:Vmn2r104	UTSW	17	20029485	missense	probably damaging	1.00
R6066:Vmn2r104	UTSW	17	20038311	missense	possibly damaging	0.69
R6156:Vmn2r104	UTSW	17	20041647	missense	probably damaging	1.00
R6182:Vmn2r104	UTSW	17	20030245	missense	probably benign	0.16
R6245:Vmn2r104	UTSW	17	20041567	missense	possibly damaging	0.69
R6333:Vmn2r104	UTSW	17	20029586	missense	probably benign	0.30
R6573:Vmn2r104	UTSW	17	20042225	missense	probably damaging	1.00
R7101:Vmn2r104	UTSW	17	20030096	missense	possibly damaging	0.65
R7123:Vmn2r104	UTSW	17	20040826	missense	probably benign	0.12
R7485:Vmn2r104	UTSW	17	20029475	missense	probably benign	0.01
R7514:Vmn2r104	UTSW	17	20029529	missense	probably damaging	1.00
R7634:Vmn2r104	UTSW	17	20041709	missense	possibly damaging	0.48
R7958:Vmn2r104	UTSW	17	20042726	missense	probably benign
R8031:Vmn2r104	UTSW	17	20042786	missense	probably benign	0.34
R8094:Vmn2r104	UTSW	17	20030221	missense	possibly damaging	0.77
R8191:Vmn2r104	UTSW	17	20030203	missense	possibly damaging	0.89
R8308:Vmn2r104	UTSW	17	20040778	missense	possibly damaging	0.55
R8691:Vmn2r104	UTSW	17	20041848	missense	probably damaging	0.98
R8795:Vmn2r104	UTSW	17	20042726	missense	probably benign
R8900:Vmn2r104	UTSW	17	20041662	missense	probably damaging	0.99
R8913:Vmn2r104	UTSW	17	20029706	missense	probably damaging	1.00
R9180:Vmn2r104	UTSW	17	20042825	missense	probably benign	0.00
R9199:Vmn2r104	UTSW	17	20041835	missense	probably damaging	0.99
R9282:Vmn2r104	UTSW	17	20040836	missense	probably damaging	1.00
R9303:Vmn2r104	UTSW	17	20048177	missense	possibly damaging	0.90
R9305:Vmn2r104	UTSW	17	20048177	missense	possibly damaging	0.90
R9322:Vmn2r104	UTSW	17	20042825	missense	probably benign	0.00
R9325:Vmn2r104	UTSW	17	20048171	missense	possibly damaging	0.95
R9414:Vmn2r104	UTSW	17	20029988	missense	probably damaging	0.99
R9785:Vmn2r104	UTSW	17	20048147	missense	probably benign
RF007:Vmn2r104	UTSW	17	20048040	missense	probably benign	0.36
Z1177:Vmn2r104	UTSW	17	20029789	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACCATTGTAAATGTTTGTGCTCTC -3'
(R):5'- AAATGATCCCAGCCACATGG -3'

Sequencing Primer
(F):5'- TGACAACATCAAATATGAAACTGGG -3'
(R):5'- GCCACATGGACCTCATATTTTACTAG -3'

Posted On

2016-07-22