Incidental Mutation 'R5279:Rgl2'
ID 404145
Institutional Source Beutler Lab
Gene Symbol Rgl2
Ensembl Gene ENSMUSG00000041354
Gene Name ral guanine nucleotide dissociation stimulator-like 2
Synonyms Rlf, Rgt2, Rab2l, KE1.5
MMRRC Submission 042839-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.101) question?
Stock # R5279 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 34148813-34156661 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34154922 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 642 (V642A)
Ref Sequence ENSEMBL: ENSMUSP00000041082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025163] [ENSMUST00000025170] [ENSMUST00000047503] [ENSMUST00000173363] [ENSMUST00000174426] [ENSMUST00000174048] [ENSMUST00000179418]
AlphaFold Q61193
PDB Structure STRUCTURE DETERMINATION OF THE RAS-BINDING DOMAIN OF THE RAL-SPECIFIC GUANINE NUCLEOTIDE EXCHANGE FACTOR RLF, NMR, 10 STRUCTURES [SOLUTION NMR]
The conformation of a docking site for SH3 domains is pre-selected in the Guanine Nucleotide Exchange Factor Rlf [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025163
SMART Domains Protein: ENSMUSP00000025163
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 9.6e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025170
SMART Domains Protein: ENSMUSP00000025170
Gene: ENSMUSG00000024312

DomainStartEndE-ValueType
coiled coil region 126 155 N/A INTRINSIC
low complexity region 204 217 N/A INTRINSIC
WD40 225 262 1.02e2 SMART
WD40 267 302 3.3e1 SMART
Blast:WD40 305 344 8e-19 BLAST
WD40 347 386 9.52e-6 SMART
Blast:WD40 392 426 3e-14 BLAST
BING4CT 439 517 8.85e-53 SMART
low complexity region 542 556 N/A INTRINSIC
low complexity region 586 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047503
AA Change: V642A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354
AA Change: V642A

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
RasGEFN 87 212 9.54e-30 SMART
RasGEF 239 514 7.15e-106 SMART
low complexity region 578 592 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
RA 649 736 2.05e-19 SMART
low complexity region 737 762 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173266
Predicted Effect unknown
Transcript: ENSMUST00000173284
AA Change: V194A
SMART Domains Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354
AA Change: V194A

DomainStartEndE-ValueType
Blast:RasGEF 2 67 1e-35 BLAST
PDB:4JGW|B 2 67 1e-35 PDB
SCOP:d1bkds_ 2 94 3e-16 SMART
low complexity region 131 145 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
RA 202 289 2.05e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173363
SMART Domains Protein: ENSMUSP00000138662
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 1 89 1.1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174442
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174676
Predicted Effect probably benign
Transcript: ENSMUST00000174426
SMART Domains Protein: ENSMUSP00000134069
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 1 89 1.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174048
SMART Domains Protein: ENSMUSP00000133656
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179418
SMART Domains Protein: ENSMUSP00000137072
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 2e-28 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (73/74)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 C A 17: 24,508,388 (GRCm39) G1049V probably damaging Het
Afdn G A 17: 14,109,214 (GRCm39) R1579H probably damaging Het
Ankrd28 T A 14: 31,456,963 (GRCm39) N386Y probably damaging Het
Atf7ip T A 6: 136,580,377 (GRCm39) Y1100* probably null Het
Atp9b T A 18: 80,956,073 (GRCm39) E3V probably damaging Het
AW554918 T G 18: 25,308,488 (GRCm39) D60E possibly damaging Het
Baz2b G T 2: 59,762,496 (GRCm39) Q927K probably damaging Het
Birc6 A G 17: 74,957,042 (GRCm39) R3659G probably damaging Het
C8a T G 4: 104,703,185 (GRCm39) N291H probably damaging Het
Calcoco1 G A 15: 102,619,420 (GRCm39) L390F probably damaging Het
Carmil3 A G 14: 55,739,028 (GRCm39) D894G probably damaging Het
Cdc20 A G 4: 118,290,711 (GRCm39) Y430H probably damaging Het
Cdc6 A T 11: 98,803,088 (GRCm39) I316F probably damaging Het
Ceacam23 T A 7: 17,607,214 (GRCm39) noncoding transcript Het
Cenpu T A 8: 47,031,945 (GRCm39) probably null Het
Csmd2 T A 4: 128,350,707 (GRCm39) V1592D probably benign Het
Csmd3 G T 15: 48,655,340 (GRCm39) probably null Het
Dnah7c T C 1: 46,558,429 (GRCm39) F512L probably benign Het
Fam136a T A 6: 86,343,686 (GRCm39) L61Q probably damaging Het
Fpgs A C 2: 32,582,779 (GRCm39) probably benign Het
Fzd4 G A 7: 89,056,881 (GRCm39) M309I probably benign Het
Gad2 A G 2: 22,563,969 (GRCm39) T391A probably benign Het
Gm11563 A T 11: 99,549,539 (GRCm39) S72T unknown Het
Gon4l A G 3: 88,794,944 (GRCm39) I716V probably benign Het
Itga9 T C 9: 118,457,273 (GRCm39) V128A probably damaging Het
Kat6a CGCAGCAGCAGCAGCAGCA CGCAGCAGCAGCA 8: 23,429,664 (GRCm39) probably benign Het
Lrrc9 T A 12: 72,542,368 (GRCm39) D1063E possibly damaging Het
Lyst T A 13: 13,823,387 (GRCm39) L1453* probably null Het
Mcm3ap T C 10: 76,343,373 (GRCm39) V1755A probably damaging Het
Mrc1 T C 2: 14,314,869 (GRCm39) S985P probably damaging Het
Mst1 A C 9: 107,959,414 (GRCm39) K233N probably damaging Het
Nr2c2ap G A 8: 70,584,653 (GRCm39) D42N probably damaging Het
Ntn1 A G 11: 68,276,538 (GRCm39) S137P probably benign Het
Pard3 T C 8: 128,186,867 (GRCm39) probably null Het
Pcdh15 T A 10: 74,430,015 (GRCm39) D1210E probably damaging Het
Pcdhga5 T C 18: 37,827,774 (GRCm39) L74P probably benign Het
Pcsk5 T C 19: 17,573,022 (GRCm39) probably null Het
Pdia3 T C 2: 121,244,484 (GRCm39) probably benign Het
Pikfyve A T 1: 65,235,858 (GRCm39) R177* probably null Het
Pklr A G 3: 89,050,566 (GRCm39) E409G probably damaging Het
Plod2 T C 9: 92,463,376 (GRCm39) Y154H probably damaging Het
Psmc3 T A 2: 90,884,667 (GRCm39) D6E probably benign Het
Ptpru T A 4: 131,547,334 (GRCm39) N205I possibly damaging Het
Rbm6 T C 9: 107,655,213 (GRCm39) E1006G probably benign Het
Rnf8 T A 17: 29,845,680 (GRCm39) H104Q possibly damaging Het
Robo4 CGG CG 9: 37,322,786 (GRCm39) probably null Het
Rpa1 T C 11: 75,204,170 (GRCm39) N269S probably damaging Het
Sdk2 A G 11: 113,757,857 (GRCm39) M519T probably benign Het
Snx30 A G 4: 59,885,070 (GRCm39) S237G probably benign Het
Spx A G 6: 142,359,766 (GRCm39) N36S probably damaging Het
Stard7 T C 2: 127,137,416 (GRCm39) Y289H probably damaging Het
Sugp2 T C 8: 70,709,757 (GRCm39) probably benign Het
Susd4 C T 1: 182,715,043 (GRCm39) T288I probably damaging Het
Tceanc2 T A 4: 107,034,826 (GRCm39) probably null Het
Tm4sf4 T G 3: 57,341,159 (GRCm39) V97G probably benign Het
Tmtc1 C T 6: 148,256,629 (GRCm39) probably benign Het
Trappc11 C T 8: 47,958,339 (GRCm39) probably benign Het
Triobp G T 15: 78,878,591 (GRCm39) V398F possibly damaging Het
Ttll9 T A 2: 152,804,464 (GRCm39) S2T possibly damaging Het
Ttn T C 2: 76,731,320 (GRCm39) probably benign Het
Tyw3 A G 3: 154,300,108 (GRCm39) C80R probably damaging Het
Usp24 T C 4: 106,242,621 (GRCm39) V1177A possibly damaging Het
Vmn1r65 A G 7: 6,011,754 (GRCm39) V160A probably damaging Het
Vmn2r104 T A 17: 20,262,146 (GRCm39) H328L probably benign Het
Vmn2r65 A C 7: 84,589,849 (GRCm39) I689S probably damaging Het
Wrn A G 8: 33,731,129 (GRCm39) Y1068H probably damaging Het
Xpo4 C A 14: 57,850,866 (GRCm39) S346I probably benign Het
Zc3h3 T A 15: 75,711,439 (GRCm39) T341S probably benign Het
Zxdc T C 6: 90,347,419 (GRCm39) M260T possibly damaging Het
Other mutations in Rgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Rgl2 APN 17 34,152,110 (GRCm39) missense probably benign 0.31
IGL00898:Rgl2 APN 17 34,152,392 (GRCm39) missense possibly damaging 0.95
IGL00965:Rgl2 APN 17 34,154,910 (GRCm39) missense probably benign 0.00
IGL00985:Rgl2 APN 17 34,151,075 (GRCm39) missense probably damaging 1.00
IGL02140:Rgl2 APN 17 34,152,098 (GRCm39) missense probably damaging 1.00
IGL02214:Rgl2 APN 17 34,154,163 (GRCm39) missense probably benign 0.06
IGL02486:Rgl2 APN 17 34,154,954 (GRCm39) missense probably damaging 0.97
IGL02579:Rgl2 APN 17 34,156,134 (GRCm39) missense probably benign 0.08
IGL02976:Rgl2 APN 17 34,152,936 (GRCm39) missense possibly damaging 0.95
Hypotenuse UTSW 17 34,150,713 (GRCm39) missense probably benign 0.00
Pedernales UTSW 17 34,151,012 (GRCm39) critical splice acceptor site probably null
PIT4354001:Rgl2 UTSW 17 34,152,914 (GRCm39) missense possibly damaging 0.80
R0347:Rgl2 UTSW 17 34,151,712 (GRCm39) missense probably damaging 1.00
R0456:Rgl2 UTSW 17 34,155,823 (GRCm39) splice site probably null
R0825:Rgl2 UTSW 17 34,154,133 (GRCm39) splice site probably null
R1742:Rgl2 UTSW 17 34,156,197 (GRCm39) splice site probably null
R1777:Rgl2 UTSW 17 34,150,718 (GRCm39) missense probably benign 0.00
R1829:Rgl2 UTSW 17 34,152,595 (GRCm39) missense probably benign 0.00
R1908:Rgl2 UTSW 17 34,151,122 (GRCm39) missense probably benign 0.00
R1961:Rgl2 UTSW 17 34,152,589 (GRCm39) missense probably damaging 1.00
R2102:Rgl2 UTSW 17 34,152,314 (GRCm39) splice site probably null
R3001:Rgl2 UTSW 17 34,151,579 (GRCm39) missense probably benign 0.00
R3002:Rgl2 UTSW 17 34,151,579 (GRCm39) missense probably benign 0.00
R3755:Rgl2 UTSW 17 34,151,571 (GRCm39) missense probably benign 0.01
R3756:Rgl2 UTSW 17 34,151,571 (GRCm39) missense probably benign 0.01
R3978:Rgl2 UTSW 17 34,154,136 (GRCm39) missense probably benign 0.02
R4042:Rgl2 UTSW 17 34,156,236 (GRCm39) missense probably damaging 1.00
R4064:Rgl2 UTSW 17 34,156,082 (GRCm39) missense possibly damaging 0.77
R4204:Rgl2 UTSW 17 34,155,906 (GRCm39) missense probably benign 0.04
R4661:Rgl2 UTSW 17 34,152,200 (GRCm39) missense possibly damaging 0.77
R4852:Rgl2 UTSW 17 34,156,147 (GRCm39) missense probably benign 0.00
R4922:Rgl2 UTSW 17 34,151,749 (GRCm39) unclassified probably benign
R5119:Rgl2 UTSW 17 34,156,094 (GRCm39) missense probably benign 0.00
R5167:Rgl2 UTSW 17 34,154,948 (GRCm39) nonsense probably null
R5319:Rgl2 UTSW 17 34,152,529 (GRCm39) missense probably benign 0.02
R5337:Rgl2 UTSW 17 34,153,958 (GRCm39) missense probably damaging 0.99
R5881:Rgl2 UTSW 17 34,151,691 (GRCm39) missense probably benign 0.01
R5945:Rgl2 UTSW 17 34,151,012 (GRCm39) critical splice acceptor site probably null
R6165:Rgl2 UTSW 17 34,150,739 (GRCm39) missense probably benign 0.01
R6358:Rgl2 UTSW 17 34,156,105 (GRCm39) splice site probably null
R6867:Rgl2 UTSW 17 34,151,661 (GRCm39) missense probably benign 0.09
R7174:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7182:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7183:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7184:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7196:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7203:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7250:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7253:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7254:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7255:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7256:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7282:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7455:Rgl2 UTSW 17 34,151,657 (GRCm39) missense probably benign 0.32
R7513:Rgl2 UTSW 17 34,151,529 (GRCm39) missense probably benign
R7752:Rgl2 UTSW 17 34,154,799 (GRCm39) missense possibly damaging 0.82
R7901:Rgl2 UTSW 17 34,154,799 (GRCm39) missense possibly damaging 0.82
R7941:Rgl2 UTSW 17 34,150,713 (GRCm39) missense probably benign 0.00
R8158:Rgl2 UTSW 17 34,155,918 (GRCm39) missense probably benign 0.27
R8209:Rgl2 UTSW 17 34,151,501 (GRCm39) missense possibly damaging 0.91
R8226:Rgl2 UTSW 17 34,151,501 (GRCm39) missense possibly damaging 0.91
R8405:Rgl2 UTSW 17 34,152,698 (GRCm39) nonsense probably null
R8871:Rgl2 UTSW 17 34,153,974 (GRCm39) missense probably damaging 1.00
R9205:Rgl2 UTSW 17 34,155,002 (GRCm39) missense probably damaging 1.00
R9591:Rgl2 UTSW 17 34,151,451 (GRCm39) missense possibly damaging 0.50
X0028:Rgl2 UTSW 17 34,151,432 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- CACATGAAGTGGCCATCAGTC -3'
(R):5'- ATCAAACAACTGCCTGAGTTCC -3'

Sequencing Primer
(F):5'- ATGAAGTGGCCATCAGTCTCATC -3'
(R):5'- TGCCTGAGTTCCACAGAAGC -3'
Posted On 2016-07-22