Incidental Mutation 'R5280:Frrs1'
ID404155
Institutional Source Beutler Lab
Gene Symbol Frrs1
Ensembl Gene ENSMUSG00000033386
Gene Nameferric-chelate reductase 1
SynonymsSdfr2
MMRRC Submission 042840-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R5280 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location116859464-116908177 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116880896 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 109 (D109G)
Ref Sequence ENSEMBL: ENSMUSP00000143255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040260] [ENSMUST00000195905] [ENSMUST00000199626]
Predicted Effect probably benign
Transcript: ENSMUST00000040260
AA Change: D109G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000039487
Gene: ENSMUSG00000033386
AA Change: D109G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Reeler 32 155 1.1e-34 PFAM
low complexity region 171 184 N/A INTRINSIC
DoH 242 331 7.72e-9 SMART
B561 372 501 1.87e-42 SMART
transmembrane domain 514 536 N/A INTRINSIC
transmembrane domain 570 589 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195905
AA Change: D109G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000143255
Gene: ENSMUSG00000033386
AA Change: D109G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Reeler 31 156 4.6e-40 PFAM
low complexity region 171 184 N/A INTRINSIC
DoH 242 331 7.72e-9 SMART
B561 372 501 1.87e-42 SMART
transmembrane domain 514 536 N/A INTRINSIC
transmembrane domain 570 589 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199626
SMART Domains Protein: ENSMUSP00000143546
Gene: ENSMUSG00000033386

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the cytochrome b561 (CYB561; MIM 600019) family, including FRRS1, reduce ferric to ferrous iron before its transport from the endosome to the cytoplasm (Vargas et al., 2003 [PubMed 14499595]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 C T 17: 43,426,334 T218I probably damaging Het
Adgrv1 C A 13: 81,397,465 S5567I possibly damaging Het
Alpk1 T C 3: 127,681,164 T397A probably benign Het
Atp9a T A 2: 168,639,988 Y880F possibly damaging Het
Celsr1 T C 15: 85,930,546 T1905A probably benign Het
Chd8 G A 14: 52,205,125 A656V possibly damaging Het
Dffa A G 4: 149,117,934 N265S probably benign Het
Gm20821 A T Y: 9,783,963 K195M probably damaging Het
Ifi207 A T 1: 173,730,304 N289K unknown Het
Kank1 T C 19: 25,411,305 F781L probably benign Het
Lrba A T 3: 86,325,022 M759L possibly damaging Het
Lrp8 A G 4: 107,854,321 Y307C probably damaging Het
Neb T C 2: 52,147,156 H6847R probably damaging Het
Olfr599 T C 7: 103,338,501 V149A probably benign Het
Olfr703 G A 7: 106,844,695 C28Y probably benign Het
Pcdha5 C A 18: 36,961,702 Y421* probably null Het
Pclo T A 5: 14,540,717 D1010E unknown Het
Pld2 A T 11: 70,552,759 D449V probably damaging Het
Ppfia1 C A 7: 144,485,095 M1032I possibly damaging Het
Prickle2 C A 6: 92,376,210 L758F probably damaging Het
Sarm1 A G 11: 78,483,476 V564A probably damaging Het
Taf1b C A 12: 24,549,438 F398L probably benign Het
Tll2 A G 19: 41,117,257 I361T possibly damaging Het
Tmem260 T C 14: 48,505,259 V517A probably benign Het
Usp24 A G 4: 106,341,214 K106E probably benign Het
Vcan C A 13: 89,690,286 V2380F probably benign Het
Vmn2r65 A G 7: 84,946,334 S381P probably damaging Het
Vmn2r73 T C 7: 85,857,947 D719G probably damaging Het
Wdr5b T C 16: 36,041,832 V107A probably benign Het
Wdr7 G T 18: 63,987,312 V1475F probably benign Het
Ythdc2 A G 18: 44,860,621 D911G probably damaging Het
Zbtb32 T A 7: 30,590,204 E11V probably damaging Het
Zfp563 T G 17: 33,104,838 Y136D probably damaging Het
Other mutations in Frrs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Frrs1 APN 3 116902400 missense probably damaging 1.00
IGL00792:Frrs1 APN 3 116885295 splice site probably null
IGL01395:Frrs1 APN 3 116901005 missense probably benign 0.02
IGL01504:Frrs1 APN 3 116900658 missense probably damaging 1.00
IGL01548:Frrs1 APN 3 116885185 missense probably damaging 1.00
IGL01924:Frrs1 APN 3 116885239 missense probably damaging 1.00
IGL03037:Frrs1 APN 3 116902467 unclassified probably benign
IGL03104:Frrs1 APN 3 116881782 missense probably benign 0.00
IGL03143:Frrs1 APN 3 116899187 missense probably damaging 0.99
R0023:Frrs1 UTSW 3 116896788 missense probably damaging 1.00
R0023:Frrs1 UTSW 3 116896788 missense probably damaging 1.00
R0051:Frrs1 UTSW 3 116885297 splice site probably benign
R0051:Frrs1 UTSW 3 116885297 splice site probably benign
R0107:Frrs1 UTSW 3 116896716 missense probably damaging 0.97
R0138:Frrs1 UTSW 3 116881807 missense possibly damaging 0.65
R0532:Frrs1 UTSW 3 116883164 missense probably benign
R0646:Frrs1 UTSW 3 116902421 missense possibly damaging 0.50
R1534:Frrs1 UTSW 3 116878408 missense probably benign 0.14
R1596:Frrs1 UTSW 3 116883199 intron probably benign
R1880:Frrs1 UTSW 3 116896795 critical splice donor site probably null
R2193:Frrs1 UTSW 3 116878345 missense probably damaging 1.00
R2851:Frrs1 UTSW 3 116885129 missense probably benign 0.00
R3177:Frrs1 UTSW 3 116899224 missense probably damaging 1.00
R3277:Frrs1 UTSW 3 116899224 missense probably damaging 1.00
R3772:Frrs1 UTSW 3 116878387 missense possibly damaging 0.71
R4457:Frrs1 UTSW 3 116896728 missense probably benign 0.10
R4887:Frrs1 UTSW 3 116902416 makesense probably null
R4957:Frrs1 UTSW 3 116885248 missense probably benign 0.00
R5015:Frrs1 UTSW 3 116878439 missense probably damaging 1.00
R5080:Frrs1 UTSW 3 116902936 missense probably benign 0.02
R5256:Frrs1 UTSW 3 116903100 missense possibly damaging 0.88
R5597:Frrs1 UTSW 3 116878238 start gained probably benign
R5887:Frrs1 UTSW 3 116896750 missense probably benign 0.32
R6210:Frrs1 UTSW 3 116878431 missense probably benign 0.19
R6268:Frrs1 UTSW 3 116903099 missense probably damaging 0.98
R6378:Frrs1 UTSW 3 116900990 missense possibly damaging 0.95
R7165:Frrs1 UTSW 3 116878271 missense probably benign 0.18
R7220:Frrs1 UTSW 3 116880776 nonsense probably null
R7301:Frrs1 UTSW 3 116895563 missense possibly damaging 0.47
R7312:Frrs1 UTSW 3 116881777 missense probably damaging 1.00
R7862:Frrs1 UTSW 3 116891880 missense possibly damaging 0.83
R7945:Frrs1 UTSW 3 116891880 missense possibly damaging 0.83
R8032:Frrs1 UTSW 3 116878360 missense probably benign 0.00
X0063:Frrs1 UTSW 3 116902422 missense possibly damaging 0.67
Z1177:Frrs1 UTSW 3 116881818 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCTGCCCGAATGTATGACTG -3'
(R):5'- AACTCTTCAAGCTATTAGCCTACC -3'

Sequencing Primer
(F):5'- CCCGAATGTATGACTGCATGATAG -3'
(R):5'- AAGCTATTAGCCTACCTTTCTAGAC -3'
Posted On2016-07-22