Incidental Mutation 'R5280:Dffa'
ID404158
Institutional Source Beutler Lab
Gene Symbol Dffa
Ensembl Gene ENSMUSG00000028974
Gene NameDNA fragmentation factor, alpha subunit
SynonymsICAD-L, A330085O09Rik, ICAD-S, DFF35, Dff45
MMRRC Submission 042840-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R5280 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location149104146-149120647 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 149117934 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 265 (N265S)
Ref Sequence ENSEMBL: ENSMUSP00000099505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030816] [ENSMUST00000103216]
Predicted Effect probably benign
Transcript: ENSMUST00000030816
SMART Domains Protein: ENSMUSP00000030816
Gene: ENSMUSG00000028974

DomainStartEndE-ValueType
CAD 19 94 1.79e-47 SMART
Pfam:DFF-C 100 264 1.1e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103216
AA Change: N265S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099505
Gene: ENSMUSG00000028974
AA Change: N265S

DomainStartEndE-ValueType
CAD 19 94 1.79e-47 SMART
Pfam:DFF-C 100 264 2.2e-80 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Apoptosis is a cell death process that removes toxic and/or useless cells during mammalian development. The apoptotic process is accompanied by shrinkage and fragmentation of the cells and nuclei and degradation of the chromosomal DNA into nucleosomal units. DNA fragmentation factor (DFF) is a heterodimeric protein of 40-kD (DFFB) and 45-kD (DFFA) subunits. DFFA is the substrate for caspase-3 and triggers DNA fragmentation during apoptosis. DFF becomes activated when DFFA is cleaved by caspase-3. The cleaved fragments of DFFA dissociate from DFFB, the active component of DFF. DFFB has been found to trigger both DNA fragmentation and chromatin condensation during apoptosis. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show increased resistance to apoptosis in response to several apoptotic stimuli, enhanced spatial learning and memory, higher granule cell density and total granule cell number in the dentate gyrus, and resistance to kainic acid-induced CA3 neuronal cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 C T 17: 43,426,334 T218I probably damaging Het
Adgrv1 C A 13: 81,397,465 S5567I possibly damaging Het
Alpk1 T C 3: 127,681,164 T397A probably benign Het
Atp9a T A 2: 168,639,988 Y880F possibly damaging Het
Celsr1 T C 15: 85,930,546 T1905A probably benign Het
Chd8 G A 14: 52,205,125 A656V possibly damaging Het
Frrs1 A G 3: 116,880,896 D109G probably benign Het
Gm20821 A T Y: 9,783,963 K195M probably damaging Het
Ifi207 A T 1: 173,730,304 N289K unknown Het
Kank1 T C 19: 25,411,305 F781L probably benign Het
Lrba A T 3: 86,325,022 M759L possibly damaging Het
Lrp8 A G 4: 107,854,321 Y307C probably damaging Het
Neb T C 2: 52,147,156 H6847R probably damaging Het
Olfr599 T C 7: 103,338,501 V149A probably benign Het
Olfr703 G A 7: 106,844,695 C28Y probably benign Het
Pcdha5 C A 18: 36,961,702 Y421* probably null Het
Pclo T A 5: 14,540,717 D1010E unknown Het
Pld2 A T 11: 70,552,759 D449V probably damaging Het
Ppfia1 C A 7: 144,485,095 M1032I possibly damaging Het
Prickle2 C A 6: 92,376,210 L758F probably damaging Het
Sarm1 A G 11: 78,483,476 V564A probably damaging Het
Taf1b C A 12: 24,549,438 F398L probably benign Het
Tll2 A G 19: 41,117,257 I361T possibly damaging Het
Tmem260 T C 14: 48,505,259 V517A probably benign Het
Usp24 A G 4: 106,341,214 K106E probably benign Het
Vcan C A 13: 89,690,286 V2380F probably benign Het
Vmn2r65 A G 7: 84,946,334 S381P probably damaging Het
Vmn2r73 T C 7: 85,857,947 D719G probably damaging Het
Wdr5b T C 16: 36,041,832 V107A probably benign Het
Wdr7 G T 18: 63,987,312 V1475F probably benign Het
Ythdc2 A G 18: 44,860,621 D911G probably damaging Het
Zbtb32 T A 7: 30,590,204 E11V probably damaging Het
Zfp563 T G 17: 33,104,838 Y136D probably damaging Het
Other mutations in Dffa
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1475:Dffa UTSW 4 149117478 missense probably damaging 1.00
R1672:Dffa UTSW 4 149106245 missense probably damaging 1.00
R1950:Dffa UTSW 4 149104382 missense probably benign 0.05
R3856:Dffa UTSW 4 149104251 start codon destroyed possibly damaging 0.62
R5185:Dffa UTSW 4 149117430 missense probably benign 0.04
R5238:Dffa UTSW 4 149104303 missense probably benign 0.04
R5514:Dffa UTSW 4 149106315 critical splice donor site probably null
X0065:Dffa UTSW 4 149119131 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGCAGAGTCCAAAGCTGC -3'
(R):5'- TTGGTGACCTGAGGGACTACAC -3'

Sequencing Primer
(F):5'- CCCTCAGTGAAGAGCTGGATG -3'
(R):5'- CTTTAGTCCCAGCACTTAGGAGG -3'
Posted On2016-07-22