Incidental Mutation 'R0417:Tbata'
ID40416
Institutional Source Beutler Lab
Gene Symbol Tbata
Ensembl Gene ENSMUSG00000020096
Gene Namethymus, brain and testes associated
SynonymsSpatial, 1700021K02Rik
MMRRC Submission 038619-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R0417 (G1)
Quality Score215
Status Not validated
Chromosome10
Chromosomal Location61171954-61188841 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 61180339 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 198 (D198V)
Ref Sequence ENSEMBL: ENSMUSP00000078227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035894] [ENSMUST00000079235] [ENSMUST00000121297] [ENSMUST00000122261] [ENSMUST00000126831] [ENSMUST00000131879] [ENSMUST00000140456] [ENSMUST00000143207] [ENSMUST00000148181] [ENSMUST00000151886]
Predicted Effect probably damaging
Transcript: ENSMUST00000035894
AA Change: D193V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000036422
Gene: ENSMUSG00000020096
AA Change: D193V

DomainStartEndE-ValueType
low complexity region 58 70 N/A INTRINSIC
low complexity region 73 87 N/A INTRINSIC
Pfam:SPATIAL 123 316 2.8e-64 PFAM
low complexity region 335 346 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079235
AA Change: D198V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078227
Gene: ENSMUSG00000020096
AA Change: D198V

DomainStartEndE-ValueType
low complexity region 63 75 N/A INTRINSIC
low complexity region 78 92 N/A INTRINSIC
Pfam:SPATIAL 128 230 2.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121297
AA Change: D159V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113253
Gene: ENSMUSG00000020096
AA Change: D159V

DomainStartEndE-ValueType
low complexity region 58 70 N/A INTRINSIC
Pfam:SPATIAL 82 191 2.2e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122261
AA Change: D159V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113902
Gene: ENSMUSG00000020096
AA Change: D159V

DomainStartEndE-ValueType
low complexity region 58 70 N/A INTRINSIC
Pfam:SPATIAL 82 282 6.7e-76 PFAM
low complexity region 301 312 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126831
AA Change: D74V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119957
Gene: ENSMUSG00000020096
AA Change: D74V

DomainStartEndE-ValueType
Pfam:SPATIAL 1 155 1.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131879
SMART Domains Protein: ENSMUSP00000118942
Gene: ENSMUSG00000020096

DomainStartEndE-ValueType
low complexity region 58 70 N/A INTRINSIC
low complexity region 73 87 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000140456
Predicted Effect silent
Transcript: ENSMUST00000143207
Predicted Effect probably damaging
Transcript: ENSMUST00000148181
AA Change: D69V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000151886
AA Change: D33V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a putative transcription factor that is highly expressed in thymic cortical stromal cells, and may be involved in T-cell development. Its expression is developmentally regulated in the testis, where it is restricted to the haploid round spermatids during spermatogenesis, and thus this gene may also have a role in the control of male germ cell development. Alternative splicing of this gene results in two sets of transcript variants: the variants containing 5 additional exons at the 3' end encode long isoforms that are highly expressed in the testis, while the variants lacking the 3' end exons encode short isoforms that are highly expressed in the thymus. Most of the transcripts encoding the short isoforms have been shown to initiate translation from non-AUG (CUG) start sites. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased thymic pithelial cells and total thymocyte numbers without altering T cell development and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700027J19Rik A G 7: 4,151,483 L102P probably damaging Het
1700030K09Rik A G 8: 72,445,400 K217R probably damaging Het
1810024B03Rik A G 2: 127,186,944 Y112H probably damaging Het
A430078G23Rik T C 8: 3,388,957 probably benign Het
Acot2 T C 12: 83,990,613 Y234H probably benign Het
Alox12e C T 11: 70,321,865 V53I probably benign Het
Ankrd50 T C 3: 38,456,361 H619R probably damaging Het
Arfgef3 A T 10: 18,603,511 L1452Q probably damaging Het
Arhgap42 T C 9: 9,180,033 S82G possibly damaging Het
Bicra C A 7: 15,972,322 R1398L probably damaging Het
Boc T C 16: 44,520,234 T118A probably benign Het
Btnl9 A G 11: 49,175,595 Y381H probably damaging Het
Cbln3 T G 14: 55,884,129 E20A probably benign Het
Csrnp3 A G 2: 66,019,543 Y171C probably benign Het
Cyp2d9 A T 15: 82,455,951 I181F probably damaging Het
Cyp7b1 T A 3: 18,096,691 T295S probably damaging Het
Dbn1 C T 13: 55,474,916 E585K probably damaging Het
Dok1 A T 6: 83,031,569 D377E probably damaging Het
Eed A T 7: 89,971,552 Y87* probably null Het
Entpd3 T C 9: 120,557,421 V156A probably damaging Het
Exo5 T A 4: 120,922,072 T199S probably damaging Het
Extl2 T C 3: 116,024,357 I106T probably benign Het
Ezh2 A G 6: 47,551,726 C291R probably benign Het
Flvcr1 A T 1: 191,011,219 M466K probably benign Het
Fras1 G T 5: 96,691,372 M1583I probably benign Het
Fzd9 G T 5: 135,249,619 R471S probably damaging Het
Galr1 A T 18: 82,405,540 F204Y probably damaging Het
Gm38394 A T 1: 133,658,538 S354T probably benign Het
Gna11 A T 10: 81,530,904 I324N probably damaging Het
Gucy1a2 A G 9: 3,759,484 E430G possibly damaging Het
Hhatl C T 9: 121,788,762 A254T probably benign Het
Ikzf1 A C 11: 11,769,352 N353T probably benign Het
Il7 T A 3: 7,576,027 T110S probably damaging Het
Keg1 A G 19: 12,711,060 N53D probably damaging Het
Klhl21 T C 4: 152,015,507 I558T probably damaging Het
Lca5l G A 16: 96,162,653 T357M probably damaging Het
Lrba T C 3: 86,715,654 S2448P probably damaging Het
Map3k6 T A 4: 133,248,082 Y709* probably null Het
Megf6 A G 4: 154,267,967 E1261G probably benign Het
Mettl3 C T 14: 52,296,698 G473D probably damaging Het
Mga A G 2: 119,902,790 I40V probably damaging Het
Mmp13 T A 9: 7,276,602 D232E probably benign Het
Nampt T C 12: 32,833,101 V95A probably benign Het
Nbeal1 T C 1: 60,247,734 V905A probably benign Het
Nomo1 A T 7: 46,068,698 E840V possibly damaging Het
Nprl2 A T 9: 107,543,298 I101F probably damaging Het
Nup160 A T 2: 90,735,427 I1378F possibly damaging Het
Ogdhl T C 14: 32,326,979 S69P probably damaging Het
Olfr1105 A T 2: 87,033,445 Y259N probably damaging Het
Olfr1240 C A 2: 89,440,175 V35L possibly damaging Het
Olfr1283 A G 2: 111,369,105 S158G possibly damaging Het
Olfr1390 T A 11: 49,340,673 I47N possibly damaging Het
Olfr143 T C 9: 38,253,864 F149S probably benign Het
Olfr870 G A 9: 20,171,214 A119V probably damaging Het
Olfr894 A G 9: 38,219,455 I211V probably benign Het
Osbpl3 C T 6: 50,348,018 V167I probably benign Het
Pclo T A 5: 14,713,022 H3836Q unknown Het
Prkcg A T 7: 3,304,304 probably null Het
Ror1 A T 4: 100,412,000 H345L possibly damaging Het
Slc36a2 C T 11: 55,181,544 probably null Het
Slc40a1 G A 1: 45,911,374 P306L possibly damaging Het
Slc9a8 C A 2: 167,457,344 T239K probably benign Het
Snapc3 A G 4: 83,450,162 I299V probably benign Het
Sp3 G A 2: 72,971,501 A56V possibly damaging Het
Spag17 T A 3: 100,065,554 S1361T probably benign Het
Sptbn2 A G 19: 4,737,926 T978A probably benign Het
Stom C A 2: 35,321,632 V126F probably damaging Het
Stpg2 A G 3: 139,218,321 T162A probably damaging Het
Stxbp6 G A 12: 44,902,957 T63M probably damaging Het
Tatdn1 A C 15: 58,921,350 I69S probably benign Het
Tbc1d5 T C 17: 50,756,705 I638V probably benign Het
Tomm70a A G 16: 57,149,903 D548G probably benign Het
Ust A G 10: 8,245,936 F303L probably damaging Het
Vps13d A G 4: 144,976,560 S4306P probably benign Het
Zfp691 A G 4: 119,170,496 S180P possibly damaging Het
Other mutations in Tbata
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01569:Tbata APN 10 61175960 nonsense probably null
IGL02311:Tbata APN 10 61179455 nonsense probably null
R1537:Tbata UTSW 10 61183491 splice site probably null
R1956:Tbata UTSW 10 61183477 missense probably damaging 0.99
R1959:Tbata UTSW 10 61175844 missense possibly damaging 0.86
R2138:Tbata UTSW 10 61179284 missense probably benign 0.40
R4835:Tbata UTSW 10 61183353 missense probably damaging 1.00
R6261:Tbata UTSW 10 61175865 missense possibly damaging 0.92
R6667:Tbata UTSW 10 61185363 missense probably damaging 1.00
R7355:Tbata UTSW 10 61174320 unclassified probably benign
R7863:Tbata UTSW 10 61175742 missense probably benign 0.02
R7946:Tbata UTSW 10 61175742 missense probably benign 0.02
X0066:Tbata UTSW 10 61188605 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTAACAACAGGCGTGGCATCTTTC -3'
(R):5'- GGGAACCCTTCTTGGATTTCTCTGC -3'

Sequencing Primer
(F):5'- TTTAGACACAGTAGCCTAAGCGTC -3'
(R):5'- CTTCTTGGATTTCTCTGCTAGGTG -3'
Posted On2013-05-23