Incidental Mutation 'R5280:Prickle2'
ID404160
Institutional Source Beutler Lab
Gene Symbol Prickle2
Ensembl Gene ENSMUSG00000030020
Gene Nameprickle planar cell polarity protein 2
Synonyms6230400G14Rik, mpk2, 6720451F06Rik
MMRRC Submission 042840-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.514) question?
Stock #R5280 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location92370908-92706155 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 92376210 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 758 (L758F)
Ref Sequence ENSEMBL: ENSMUSP00000109074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032093] [ENSMUST00000113445] [ENSMUST00000113446] [ENSMUST00000113447]
Predicted Effect probably damaging
Transcript: ENSMUST00000032093
AA Change: L814F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032093
Gene: ENSMUSG00000030020
AA Change: L814F

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Pfam:PET 76 176 1.2e-45 PFAM
LIM 185 242 3.05e-10 SMART
LIM 250 302 5.43e-16 SMART
LIM 310 365 2.92e-7 SMART
low complexity region 465 477 N/A INTRINSIC
low complexity region 534 546 N/A INTRINSIC
low complexity region 725 753 N/A INTRINSIC
low complexity region 832 841 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113445
AA Change: L758F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109072
Gene: ENSMUSG00000030020
AA Change: L758F

DomainStartEndE-ValueType
Pfam:PET 17 122 8.9e-47 PFAM
LIM 129 186 3.05e-10 SMART
LIM 194 246 5.43e-16 SMART
LIM 254 309 2.92e-7 SMART
low complexity region 409 421 N/A INTRINSIC
low complexity region 478 490 N/A INTRINSIC
low complexity region 669 697 N/A INTRINSIC
low complexity region 776 785 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113446
AA Change: L758F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109073
Gene: ENSMUSG00000030020
AA Change: L758F

DomainStartEndE-ValueType
Pfam:PET 17 122 8.9e-47 PFAM
LIM 129 186 3.05e-10 SMART
LIM 194 246 5.43e-16 SMART
LIM 254 309 2.92e-7 SMART
low complexity region 409 421 N/A INTRINSIC
low complexity region 478 490 N/A INTRINSIC
low complexity region 669 697 N/A INTRINSIC
low complexity region 776 785 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113447
AA Change: L758F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109074
Gene: ENSMUSG00000030020
AA Change: L758F

DomainStartEndE-ValueType
Pfam:PET 17 122 8.9e-47 PFAM
LIM 129 186 3.05e-10 SMART
LIM 194 246 5.43e-16 SMART
LIM 254 309 2.92e-7 SMART
low complexity region 409 421 N/A INTRINSIC
low complexity region 478 490 N/A INTRINSIC
low complexity region 669 697 N/A INTRINSIC
low complexity region 776 785 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homolog of Drosophila prickle. The exact function of this gene is not known, however, studies in mice suggest that it may be involved in seizure prevention. Mutations in this gene are associated with progressive myoclonic epilepsy type 5. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to electroconvulsive or PTZ-induced seizures. Mice heterozygous for a knock-out allele exhibit increased susceptibility to electroconvulsive seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 C T 17: 43,426,334 T218I probably damaging Het
Adgrv1 C A 13: 81,397,465 S5567I possibly damaging Het
Alpk1 T C 3: 127,681,164 T397A probably benign Het
Atp9a T A 2: 168,639,988 Y880F possibly damaging Het
Celsr1 T C 15: 85,930,546 T1905A probably benign Het
Chd8 G A 14: 52,205,125 A656V possibly damaging Het
Dffa A G 4: 149,117,934 N265S probably benign Het
Frrs1 A G 3: 116,880,896 D109G probably benign Het
Gm20821 A T Y: 9,783,963 K195M probably damaging Het
Ifi207 A T 1: 173,730,304 N289K unknown Het
Kank1 T C 19: 25,411,305 F781L probably benign Het
Lrba A T 3: 86,325,022 M759L possibly damaging Het
Lrp8 A G 4: 107,854,321 Y307C probably damaging Het
Neb T C 2: 52,147,156 H6847R probably damaging Het
Olfr599 T C 7: 103,338,501 V149A probably benign Het
Olfr703 G A 7: 106,844,695 C28Y probably benign Het
Pcdha5 C A 18: 36,961,702 Y421* probably null Het
Pclo T A 5: 14,540,717 D1010E unknown Het
Pld2 A T 11: 70,552,759 D449V probably damaging Het
Ppfia1 C A 7: 144,485,095 M1032I possibly damaging Het
Sarm1 A G 11: 78,483,476 V564A probably damaging Het
Taf1b C A 12: 24,549,438 F398L probably benign Het
Tll2 A G 19: 41,117,257 I361T possibly damaging Het
Tmem260 T C 14: 48,505,259 V517A probably benign Het
Usp24 A G 4: 106,341,214 K106E probably benign Het
Vcan C A 13: 89,690,286 V2380F probably benign Het
Vmn2r65 A G 7: 84,946,334 S381P probably damaging Het
Vmn2r73 T C 7: 85,857,947 D719G probably damaging Het
Wdr5b T C 16: 36,041,832 V107A probably benign Het
Wdr7 G T 18: 63,987,312 V1475F probably benign Het
Ythdc2 A G 18: 44,860,621 D911G probably damaging Het
Zbtb32 T A 7: 30,590,204 E11V probably damaging Het
Zfp563 T G 17: 33,104,838 Y136D probably damaging Het
Other mutations in Prickle2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02962:Prickle2 APN 6 92376422 missense probably benign 0.00
R0028:Prickle2 UTSW 6 92422342 missense probably benign 0.12
R0122:Prickle2 UTSW 6 92411345 nonsense probably null
R0555:Prickle2 UTSW 6 92458565 missense probably benign 0.02
R0940:Prickle2 UTSW 6 92411003 missense probably benign 0.02
R1394:Prickle2 UTSW 6 92376382 missense possibly damaging 0.87
R1470:Prickle2 UTSW 6 92458602 missense probably damaging 0.96
R1470:Prickle2 UTSW 6 92458602 missense probably damaging 0.96
R1599:Prickle2 UTSW 6 92410874 missense probably benign
R1745:Prickle2 UTSW 6 92376593 missense probably damaging 1.00
R1801:Prickle2 UTSW 6 92416904 missense probably damaging 0.98
R1985:Prickle2 UTSW 6 92411452 missense probably damaging 1.00
R2085:Prickle2 UTSW 6 92376364 missense probably damaging 0.96
R2147:Prickle2 UTSW 6 92425671 missense probably damaging 0.99
R2148:Prickle2 UTSW 6 92425671 missense probably damaging 0.99
R2571:Prickle2 UTSW 6 92705400 missense probably benign 0.09
R3547:Prickle2 UTSW 6 92411137 missense probably damaging 1.00
R4356:Prickle2 UTSW 6 92411509 missense probably damaging 1.00
R4569:Prickle2 UTSW 6 92422342 missense probably benign 0.12
R4896:Prickle2 UTSW 6 92416755 missense probably benign 0.26
R5004:Prickle2 UTSW 6 92416755 missense probably benign 0.26
R5045:Prickle2 UTSW 6 92376394 missense probably damaging 0.96
R5219:Prickle2 UTSW 6 92376530 missense probably benign
R5247:Prickle2 UTSW 6 92375969 missense probably damaging 1.00
R5334:Prickle2 UTSW 6 92425684 missense probably damaging 1.00
R5780:Prickle2 UTSW 6 92458612 missense probably benign 0.06
R5960:Prickle2 UTSW 6 92376305 missense probably benign 0.08
R6084:Prickle2 UTSW 6 92416848 nonsense probably null
R6362:Prickle2 UTSW 6 92458615 missense possibly damaging 0.77
R6368:Prickle2 UTSW 6 92420237 missense probably damaging 1.00
R6852:Prickle2 UTSW 6 92376544 missense probably benign
R7041:Prickle2 UTSW 6 92376305 missense probably benign 0.08
R7203:Prickle2 UTSW 6 92410978 missense possibly damaging 0.61
R7352:Prickle2 UTSW 6 92410890 missense probably benign 0.00
R7405:Prickle2 UTSW 6 92458543 missense probably damaging 0.96
R7510:Prickle2 UTSW 6 92376470 missense possibly damaging 0.58
R7562:Prickle2 UTSW 6 92375948 makesense probably null
R7578:Prickle2 UTSW 6 92411290 missense probably benign 0.32
R7614:Prickle2 UTSW 6 92425650 missense possibly damaging 0.46
R7732:Prickle2 UTSW 6 92411224 missense probably damaging 1.00
X0020:Prickle2 UTSW 6 92416853 missense probably damaging 0.98
X0026:Prickle2 UTSW 6 92411426 nonsense probably null
X0066:Prickle2 UTSW 6 92376433 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAACTGTCCTCTGCCACCTAAG -3'
(R):5'- ACGTTCTCGCTCAGACAAC -3'

Sequencing Primer
(F):5'- ACACCGTAAGAGCTGTATTTGTGC -3'
(R):5'- TCGCTCAGACAACGCCCTG -3'
Posted On2016-07-22