Incidental Mutation 'R5280:Zbtb32'
ID404161
Institutional Source Beutler Lab
Gene Symbol Zbtb32
Ensembl Gene ENSMUSG00000006310
Gene Namezinc finger and BTB domain containing 32
SynonymsTzfp, Rog, 4930524C15Rik, PLZP
MMRRC Submission 042840-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5280 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location30589681-30598909 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30590204 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 11 (E11V)
Ref Sequence ENSEMBL: ENSMUSP00000103785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006470] [ENSMUST00000108150] [ENSMUST00000108151] [ENSMUST00000108154]
Predicted Effect probably benign
Transcript: ENSMUST00000006470
SMART Domains Protein: ENSMUSP00000006470
Gene: ENSMUSG00000006307

DomainStartEndE-ValueType
AT_hook 18 30 2.82e2 SMART
low complexity region 66 106 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
AT_hook 149 159 2.4e2 SMART
AT_hook 218 230 1.95e2 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 272 302 N/A INTRINSIC
coiled coil region 353 413 N/A INTRINSIC
AT_hook 476 488 5.47e-1 SMART
low complexity region 501 517 N/A INTRINSIC
low complexity region 578 606 N/A INTRINSIC
low complexity region 621 657 N/A INTRINSIC
low complexity region 673 700 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 738 777 N/A INTRINSIC
low complexity region 910 922 N/A INTRINSIC
Pfam:zf-CXXC 963 1010 7.2e-15 PFAM
low complexity region 1039 1061 N/A INTRINSIC
low complexity region 1103 1115 N/A INTRINSIC
PHD 1209 1256 1.25e-5 SMART
PHD 1257 1307 5.4e-10 SMART
PHD 1343 1400 1.27e-6 SMART
low complexity region 1415 1427 N/A INTRINSIC
PHD 1646 1692 3.82e-1 SMART
FYRN 1745 1788 3.25e-19 SMART
low complexity region 1881 1899 N/A INTRINSIC
low complexity region 1912 1942 N/A INTRINSIC
low complexity region 1961 1978 N/A INTRINSIC
low complexity region 1991 2003 N/A INTRINSIC
low complexity region 2013 2026 N/A INTRINSIC
low complexity region 2048 2061 N/A INTRINSIC
low complexity region 2087 2105 N/A INTRINSIC
low complexity region 2127 2138 N/A INTRINSIC
low complexity region 2215 2235 N/A INTRINSIC
low complexity region 2239 2270 N/A INTRINSIC
low complexity region 2396 2406 N/A INTRINSIC
FYRC 2419 2504 4.83e-36 SMART
SET 2581 2703 1.67e-42 SMART
PostSET 2705 2721 4.65e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108150
AA Change: E11V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103785
Gene: ENSMUSG00000006310
AA Change: E11V

DomainStartEndE-ValueType
ZnF_C2H2 14 36 1.67e-2 SMART
ZnF_C2H2 41 63 2.4e-3 SMART
low complexity region 81 101 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108151
AA Change: E375V

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103786
Gene: ENSMUSG00000006310
AA Change: E375V

DomainStartEndE-ValueType
BTB 29 117 1.67e-8 SMART
low complexity region 207 222 N/A INTRINSIC
ZnF_C2H2 350 372 1.28e-3 SMART
ZnF_C2H2 378 400 1.67e-2 SMART
ZnF_C2H2 405 427 2.4e-3 SMART
low complexity region 445 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108154
SMART Domains Protein: ENSMUSP00000103789
Gene: ENSMUSG00000006307

DomainStartEndE-ValueType
AT_hook 18 30 2.82e2 SMART
low complexity region 66 106 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
AT_hook 149 159 2.4e2 SMART
AT_hook 218 230 1.95e2 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 272 302 N/A INTRINSIC
coiled coil region 353 413 N/A INTRINSIC
AT_hook 476 488 5.47e-1 SMART
low complexity region 501 517 N/A INTRINSIC
low complexity region 578 606 N/A INTRINSIC
low complexity region 621 657 N/A INTRINSIC
low complexity region 673 700 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 738 777 N/A INTRINSIC
low complexity region 910 922 N/A INTRINSIC
Pfam:zf-CXXC 963 1010 1e-14 PFAM
low complexity region 1039 1061 N/A INTRINSIC
low complexity region 1103 1115 N/A INTRINSIC
PHD 1209 1256 1.25e-5 SMART
PHD 1257 1307 5.4e-10 SMART
PHD 1343 1400 1.27e-6 SMART
low complexity region 1415 1427 N/A INTRINSIC
PHD 1646 1692 3.82e-1 SMART
FYRN 1745 1788 3.25e-19 SMART
low complexity region 1872 1890 N/A INTRINSIC
low complexity region 1903 1933 N/A INTRINSIC
low complexity region 1952 1969 N/A INTRINSIC
low complexity region 1982 1994 N/A INTRINSIC
low complexity region 2004 2017 N/A INTRINSIC
low complexity region 2039 2052 N/A INTRINSIC
low complexity region 2078 2096 N/A INTRINSIC
low complexity region 2118 2129 N/A INTRINSIC
low complexity region 2206 2226 N/A INTRINSIC
low complexity region 2230 2261 N/A INTRINSIC
low complexity region 2383 2398 N/A INTRINSIC
FYRC 2411 2496 4.83e-36 SMART
SET 2573 2695 1.67e-42 SMART
PostSET 2697 2713 4.65e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131002
SMART Domains Protein: ENSMUSP00000118486
Gene: ENSMUSG00000006307

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 30 69 N/A INTRINSIC
low complexity region 202 214 N/A INTRINSIC
Pfam:zf-CXXC 255 302 5.2e-15 PFAM
low complexity region 331 353 N/A INTRINSIC
low complexity region 395 407 N/A INTRINSIC
PHD 501 548 1.25e-5 SMART
PHD 549 599 5.4e-10 SMART
PHD 635 692 1.27e-6 SMART
low complexity region 707 719 N/A INTRINSIC
PHD 938 984 3.82e-1 SMART
FYRN 1037 1080 3.25e-19 SMART
low complexity region 1173 1191 N/A INTRINSIC
low complexity region 1204 1234 N/A INTRINSIC
low complexity region 1253 1270 N/A INTRINSIC
low complexity region 1283 1295 N/A INTRINSIC
low complexity region 1305 1318 N/A INTRINSIC
low complexity region 1340 1353 N/A INTRINSIC
low complexity region 1379 1397 N/A INTRINSIC
low complexity region 1419 1430 N/A INTRINSIC
low complexity region 1507 1527 N/A INTRINSIC
low complexity region 1531 1562 N/A INTRINSIC
low complexity region 1684 1699 N/A INTRINSIC
FYRC 1712 1797 4.83e-36 SMART
SET 1874 1996 1.67e-42 SMART
PostSET 1998 2014 4.65e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185080
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display increased T cell proliferation and increased cytokine secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 C T 17: 43,426,334 T218I probably damaging Het
Adgrv1 C A 13: 81,397,465 S5567I possibly damaging Het
Alpk1 T C 3: 127,681,164 T397A probably benign Het
Atp9a T A 2: 168,639,988 Y880F possibly damaging Het
Celsr1 T C 15: 85,930,546 T1905A probably benign Het
Chd8 G A 14: 52,205,125 A656V possibly damaging Het
Dffa A G 4: 149,117,934 N265S probably benign Het
Frrs1 A G 3: 116,880,896 D109G probably benign Het
Gm20821 A T Y: 9,783,963 K195M probably damaging Het
Ifi207 A T 1: 173,730,304 N289K unknown Het
Kank1 T C 19: 25,411,305 F781L probably benign Het
Lrba A T 3: 86,325,022 M759L possibly damaging Het
Lrp8 A G 4: 107,854,321 Y307C probably damaging Het
Neb T C 2: 52,147,156 H6847R probably damaging Het
Olfr599 T C 7: 103,338,501 V149A probably benign Het
Olfr703 G A 7: 106,844,695 C28Y probably benign Het
Pcdha5 C A 18: 36,961,702 Y421* probably null Het
Pclo T A 5: 14,540,717 D1010E unknown Het
Pld2 A T 11: 70,552,759 D449V probably damaging Het
Ppfia1 C A 7: 144,485,095 M1032I possibly damaging Het
Prickle2 C A 6: 92,376,210 L758F probably damaging Het
Sarm1 A G 11: 78,483,476 V564A probably damaging Het
Taf1b C A 12: 24,549,438 F398L probably benign Het
Tll2 A G 19: 41,117,257 I361T possibly damaging Het
Tmem260 T C 14: 48,505,259 V517A probably benign Het
Usp24 A G 4: 106,341,214 K106E probably benign Het
Vcan C A 13: 89,690,286 V2380F probably benign Het
Vmn2r65 A G 7: 84,946,334 S381P probably damaging Het
Vmn2r73 T C 7: 85,857,947 D719G probably damaging Het
Wdr5b T C 16: 36,041,832 V107A probably benign Het
Wdr7 G T 18: 63,987,312 V1475F probably benign Het
Ythdc2 A G 18: 44,860,621 D911G probably damaging Het
Zfp563 T G 17: 33,104,838 Y136D probably damaging Het
Other mutations in Zbtb32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01954:Zbtb32 APN 7 30589928 unclassified probably null
R1173:Zbtb32 UTSW 7 30591267 missense possibly damaging 0.86
R2129:Zbtb32 UTSW 7 30591493 missense possibly damaging 0.53
R3883:Zbtb32 UTSW 7 30591144 missense probably benign 0.33
R4934:Zbtb32 UTSW 7 30591253 missense possibly damaging 0.53
R5070:Zbtb32 UTSW 7 30591466 missense probably benign 0.01
R6091:Zbtb32 UTSW 7 30591829 missense possibly damaging 0.48
R6401:Zbtb32 UTSW 7 30591819 missense probably damaging 1.00
R7366:Zbtb32 UTSW 7 30590181 missense probably damaging 1.00
X0022:Zbtb32 UTSW 7 30589930 makesense probably null
Predicted Primers PCR Primer
(F):5'- TGTCAAGCCAGAGAAGCTACC -3'
(R):5'- ACCGAGTCCACACAGGTATG -3'

Sequencing Primer
(F):5'- TCGGCCTCGAGGAAGAG -3'
(R):5'- AGTCCACACAGGTATGGGCATC -3'
Posted On2016-07-22