Incidental Mutation 'R5280:Olfr599'
ID404164
Institutional Source Beutler Lab
Gene Symbol Olfr599
Ensembl Gene ENSMUSG00000073950
Gene Nameolfactory receptor 599
SynonymsGA_x6K02T2PBJ9-6047402-6048349, MOR23-1
MMRRC Submission 042840-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5280 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103335917-103339564 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103338501 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 149 (V149A)
Ref Sequence ENSEMBL: ENSMUSP00000149281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098201] [ENSMUST00000214329] [ENSMUST00000215042]
Predicted Effect probably benign
Transcript: ENSMUST00000098201
AA Change: V149A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095803
Gene: ENSMUSG00000073950
AA Change: V149A

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 1.8e-94 PFAM
Pfam:7TM_GPCR_Srsx 37 308 1.2e-6 PFAM
Pfam:7tm_1 43 293 2.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214329
AA Change: V149A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215042
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 C T 17: 43,426,334 T218I probably damaging Het
Adgrv1 C A 13: 81,397,465 S5567I possibly damaging Het
Alpk1 T C 3: 127,681,164 T397A probably benign Het
Atp9a T A 2: 168,639,988 Y880F possibly damaging Het
Celsr1 T C 15: 85,930,546 T1905A probably benign Het
Chd8 G A 14: 52,205,125 A656V possibly damaging Het
Dffa A G 4: 149,117,934 N265S probably benign Het
Frrs1 A G 3: 116,880,896 D109G probably benign Het
Gm20821 A T Y: 9,783,963 K195M probably damaging Het
Ifi207 A T 1: 173,730,304 N289K unknown Het
Kank1 T C 19: 25,411,305 F781L probably benign Het
Lrba A T 3: 86,325,022 M759L possibly damaging Het
Lrp8 A G 4: 107,854,321 Y307C probably damaging Het
Neb T C 2: 52,147,156 H6847R probably damaging Het
Olfr703 G A 7: 106,844,695 C28Y probably benign Het
Pcdha5 C A 18: 36,961,702 Y421* probably null Het
Pclo T A 5: 14,540,717 D1010E unknown Het
Pld2 A T 11: 70,552,759 D449V probably damaging Het
Ppfia1 C A 7: 144,485,095 M1032I possibly damaging Het
Prickle2 C A 6: 92,376,210 L758F probably damaging Het
Sarm1 A G 11: 78,483,476 V564A probably damaging Het
Taf1b C A 12: 24,549,438 F398L probably benign Het
Tll2 A G 19: 41,117,257 I361T possibly damaging Het
Tmem260 T C 14: 48,505,259 V517A probably benign Het
Usp24 A G 4: 106,341,214 K106E probably benign Het
Vcan C A 13: 89,690,286 V2380F probably benign Het
Vmn2r65 A G 7: 84,946,334 S381P probably damaging Het
Vmn2r73 T C 7: 85,857,947 D719G probably damaging Het
Wdr5b T C 16: 36,041,832 V107A probably benign Het
Wdr7 G T 18: 63,987,312 V1475F probably benign Het
Ythdc2 A G 18: 44,860,621 D911G probably damaging Het
Zbtb32 T A 7: 30,590,204 E11V probably damaging Het
Zfp563 T G 17: 33,104,838 Y136D probably damaging Het
Other mutations in Olfr599
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Olfr599 APN 7 103338767 nonsense probably null
IGL01744:Olfr599 APN 7 103338228 missense probably damaging 0.98
IGL02011:Olfr599 APN 7 103338849 missense probably damaging 0.98
IGL02328:Olfr599 APN 7 103338290 missense probably damaging 1.00
IGL02630:Olfr599 APN 7 103338429 missense probably damaging 1.00
IGL03119:Olfr599 APN 7 103338722 missense probably damaging 1.00
PIT4468001:Olfr599 UTSW 7 103338600 missense probably damaging 1.00
R0599:Olfr599 UTSW 7 103338186 missense probably damaging 1.00
R4084:Olfr599 UTSW 7 103338320 missense probably damaging 0.99
R5068:Olfr599 UTSW 7 103338022 start gained probably null
R5069:Olfr599 UTSW 7 103338022 start gained probably null
R5816:Olfr599 UTSW 7 103338995 missense probably benign 0.00
R6560:Olfr599 UTSW 7 103338738 missense probably benign 0.02
R7001:Olfr599 UTSW 7 103338221 missense possibly damaging 0.51
R7890:Olfr599 UTSW 7 103338330 missense probably benign
R8295:Olfr599 UTSW 7 103338267 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CATGGCTTTTGATGCTTGCC -3'
(R):5'- TGAATGCTTTGCTTCGTGCC -3'

Sequencing Primer
(F):5'- GATGCTTGCCTCACCCAG -3'
(R):5'- CTCTTTCTGAGGAAGACGAAAAAC -3'
Posted On2016-07-22