Incidental Mutation 'R5280:Olfr703'
ID404165
Institutional Source Beutler Lab
Gene Symbol Olfr703
Ensembl Gene ENSMUSG00000073901
Gene Nameolfactory receptor 703
SynonymsMOR283-7, GA_x6K02T2PBJ9-9222217-9223176
MMRRC Submission 042840-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R5280 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location106843360-106846207 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106844695 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 28 (C28Y)
Ref Sequence ENSEMBL: ENSMUSP00000149022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098142] [ENSMUST00000216254]
Predicted Effect probably benign
Transcript: ENSMUST00000098142
AA Change: C28Y

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000095746
Gene: ENSMUSG00000073901
AA Change: C28Y

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.8e-47 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.4e-8 PFAM
Pfam:7tm_1 41 290 1.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216254
AA Change: C28Y

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 C T 17: 43,426,334 T218I probably damaging Het
Adgrv1 C A 13: 81,397,465 S5567I possibly damaging Het
Alpk1 T C 3: 127,681,164 T397A probably benign Het
Atp9a T A 2: 168,639,988 Y880F possibly damaging Het
Celsr1 T C 15: 85,930,546 T1905A probably benign Het
Chd8 G A 14: 52,205,125 A656V possibly damaging Het
Dffa A G 4: 149,117,934 N265S probably benign Het
Frrs1 A G 3: 116,880,896 D109G probably benign Het
Gm20821 A T Y: 9,783,963 K195M probably damaging Het
Ifi207 A T 1: 173,730,304 N289K unknown Het
Kank1 T C 19: 25,411,305 F781L probably benign Het
Lrba A T 3: 86,325,022 M759L possibly damaging Het
Lrp8 A G 4: 107,854,321 Y307C probably damaging Het
Neb T C 2: 52,147,156 H6847R probably damaging Het
Olfr599 T C 7: 103,338,501 V149A probably benign Het
Pcdha5 C A 18: 36,961,702 Y421* probably null Het
Pclo T A 5: 14,540,717 D1010E unknown Het
Pld2 A T 11: 70,552,759 D449V probably damaging Het
Ppfia1 C A 7: 144,485,095 M1032I possibly damaging Het
Prickle2 C A 6: 92,376,210 L758F probably damaging Het
Sarm1 A G 11: 78,483,476 V564A probably damaging Het
Taf1b C A 12: 24,549,438 F398L probably benign Het
Tll2 A G 19: 41,117,257 I361T possibly damaging Het
Tmem260 T C 14: 48,505,259 V517A probably benign Het
Usp24 A G 4: 106,341,214 K106E probably benign Het
Vcan C A 13: 89,690,286 V2380F probably benign Het
Vmn2r65 A G 7: 84,946,334 S381P probably damaging Het
Vmn2r73 T C 7: 85,857,947 D719G probably damaging Het
Wdr5b T C 16: 36,041,832 V107A probably benign Het
Wdr7 G T 18: 63,987,312 V1475F probably benign Het
Ythdc2 A G 18: 44,860,621 D911G probably damaging Het
Zbtb32 T A 7: 30,590,204 E11V probably damaging Het
Zfp563 T G 17: 33,104,838 Y136D probably damaging Het
Other mutations in Olfr703
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Olfr703 APN 7 106845367 missense possibly damaging 0.78
IGL01321:Olfr703 APN 7 106844749 missense probably damaging 1.00
IGL02169:Olfr703 APN 7 106845266 nonsense probably null
IGL03376:Olfr703 APN 7 106845470 missense probably damaging 1.00
R0045:Olfr703 UTSW 7 106845389 nonsense probably null
R0662:Olfr703 UTSW 7 106844649 missense probably benign 0.01
R1589:Olfr703 UTSW 7 106845196 missense possibly damaging 0.57
R1869:Olfr703 UTSW 7 106845094 missense probably benign 0.01
R2431:Olfr703 UTSW 7 106845391 missense possibly damaging 0.95
R4021:Olfr703 UTSW 7 106845019 missense probably damaging 1.00
R6352:Olfr703 UTSW 7 106845222 missense probably damaging 1.00
R6932:Olfr703 UTSW 7 106844802 nonsense probably null
R7037:Olfr703 UTSW 7 106845336 missense probably damaging 1.00
R7909:Olfr703 UTSW 7 106844992 missense probably benign 0.29
R7990:Olfr703 UTSW 7 106844992 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TCTAGAGTTGAATACCTCCTTTGAG -3'
(R):5'- ATCTGAAGAGCACAGCCTCC -3'

Sequencing Primer
(F):5'- CCTCCTTTGAGGTAATTGAGT -3'
(R):5'- CTTTGAGCAGAAAATCTATGACAGCC -3'
Posted On2016-07-22