Incidental Mutation 'R5280:Sarm1'
ID404168
Institutional Source Beutler Lab
Gene Symbol Sarm1
Ensembl Gene ENSMUSG00000050132
Gene Namesterile alpha and HEAT/Armadillo motif containing 1
SynonymsA830091I15Rik, MyD88-5
MMRRC Submission 042840-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R5280 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location78472330-78497754 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78483476 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 564 (V564A)
Ref Sequence ENSEMBL: ENSMUSP00000051059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061174] [ENSMUST00000108287]
Predicted Effect probably damaging
Transcript: ENSMUST00000061174
AA Change: V564A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051059
Gene: ENSMUSG00000050132
AA Change: V564A

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 121 133 N/A INTRINSIC
low complexity region 221 236 N/A INTRINSIC
low complexity region 325 339 N/A INTRINSIC
SAM 409 476 1.46e-19 SMART
SAM 479 548 9.5e-10 SMART
TIR 561 702 6.73e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108287
AA Change: V604A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103922
Gene: ENSMUSG00000050132
AA Change: V604A

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 121 133 N/A INTRINSIC
low complexity region 221 236 N/A INTRINSIC
low complexity region 325 339 N/A INTRINSIC
SAM 409 476 1.46e-19 SMART
SAM 479 548 2.15e-8 SMART
TIR 601 742 6.73e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153534
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170674
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit reduced apoptosis induced by oxygen and glucose deprivation in hippocampal slices. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 C T 17: 43,426,334 T218I probably damaging Het
Adgrv1 C A 13: 81,397,465 S5567I possibly damaging Het
Alpk1 T C 3: 127,681,164 T397A probably benign Het
Atp9a T A 2: 168,639,988 Y880F possibly damaging Het
Celsr1 T C 15: 85,930,546 T1905A probably benign Het
Chd8 G A 14: 52,205,125 A656V possibly damaging Het
Dffa A G 4: 149,117,934 N265S probably benign Het
Frrs1 A G 3: 116,880,896 D109G probably benign Het
Gm20821 A T Y: 9,783,963 K195M probably damaging Het
Ifi207 A T 1: 173,730,304 N289K unknown Het
Kank1 T C 19: 25,411,305 F781L probably benign Het
Lrba A T 3: 86,325,022 M759L possibly damaging Het
Lrp8 A G 4: 107,854,321 Y307C probably damaging Het
Neb T C 2: 52,147,156 H6847R probably damaging Het
Olfr599 T C 7: 103,338,501 V149A probably benign Het
Olfr703 G A 7: 106,844,695 C28Y probably benign Het
Pcdha5 C A 18: 36,961,702 Y421* probably null Het
Pclo T A 5: 14,540,717 D1010E unknown Het
Pld2 A T 11: 70,552,759 D449V probably damaging Het
Ppfia1 C A 7: 144,485,095 M1032I possibly damaging Het
Prickle2 C A 6: 92,376,210 L758F probably damaging Het
Taf1b C A 12: 24,549,438 F398L probably benign Het
Tll2 A G 19: 41,117,257 I361T possibly damaging Het
Tmem260 T C 14: 48,505,259 V517A probably benign Het
Usp24 A G 4: 106,341,214 K106E probably benign Het
Vcan C A 13: 89,690,286 V2380F probably benign Het
Vmn2r65 A G 7: 84,946,334 S381P probably damaging Het
Vmn2r73 T C 7: 85,857,947 D719G probably damaging Het
Wdr5b T C 16: 36,041,832 V107A probably benign Het
Wdr7 G T 18: 63,987,312 V1475F probably benign Het
Ythdc2 A G 18: 44,860,621 D911G probably damaging Het
Zbtb32 T A 7: 30,590,204 E11V probably damaging Het
Zfp563 T G 17: 33,104,838 Y136D probably damaging Het
Other mutations in Sarm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Sarm1 APN 11 78490811 missense probably damaging 0.96
IGL01484:Sarm1 APN 11 78491013 missense probably damaging 1.00
IGL02591:Sarm1 APN 11 78487352 missense probably damaging 1.00
R0027:Sarm1 UTSW 11 78488091 missense probably damaging 1.00
R0282:Sarm1 UTSW 11 78474980 nonsense probably null
R1583:Sarm1 UTSW 11 78483327 nonsense probably null
R1800:Sarm1 UTSW 11 78490994 missense possibly damaging 0.87
R2101:Sarm1 UTSW 11 78475289 missense probably damaging 1.00
R2131:Sarm1 UTSW 11 78475307 missense probably benign 0.00
R4474:Sarm1 UTSW 11 78497101 missense probably benign 0.01
R5191:Sarm1 UTSW 11 78497119 nonsense probably null
R5285:Sarm1 UTSW 11 78497439 missense probably benign
R5954:Sarm1 UTSW 11 78490602 nonsense probably null
R6027:Sarm1 UTSW 11 78483558 missense probably benign
R7343:Sarm1 UTSW 11 78497257 missense possibly damaging 0.71
V7732:Sarm1 UTSW 11 78488065 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTTGTCCTCGAATTTGCCGG -3'
(R):5'- ATCAGGTCACTTTGCCCAG -3'

Sequencing Primer
(F):5'- AGCTTCTCCACGTCGATGAAG -3'
(R):5'- CAGACTGGCCTGAGAAGCTTG -3'
Posted On2016-07-22