Incidental Mutation 'R5280:Wdr5b'
ID404176
Institutional Source Beutler Lab
Gene Symbol Wdr5b
Ensembl Gene ENSMUSG00000034379
Gene NameWD repeat domain 5B
Synonyms
MMRRC Submission 042840-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R5280 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location36041190-36043928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36041832 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 107 (V107A)
Ref Sequence ENSEMBL: ENSMUSP00000040852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004054] [ENSMUST00000004057] [ENSMUST00000042203] [ENSMUST00000231351]
Predicted Effect probably benign
Transcript: ENSMUST00000004054
SMART Domains Protein: ENSMUSP00000004054
Gene: ENSMUSG00000022905

DomainStartEndE-ValueType
Pfam:IBB 6 104 1.3e-27 PFAM
ARM 115 156 1.47e-2 SMART
ARM 158 198 2.51e-10 SMART
ARM 200 241 7.16e-6 SMART
ARM 244 283 2.22e1 SMART
ARM 285 325 1.45e-6 SMART
ARM 327 367 1.12e-7 SMART
ARM 369 409 1.76e-5 SMART
ARM 412 452 2.91e-6 SMART
Pfam:Arm_3 466 516 6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000004057
SMART Domains Protein: ENSMUSP00000004057
Gene: ENSMUSG00000003955

DomainStartEndE-ValueType
Pfam:DUF1075 10 155 1.8e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042203
AA Change: V107A

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000040852
Gene: ENSMUSG00000034379
AA Change: V107A

DomainStartEndE-ValueType
WD40 28 67 5.95e-7 SMART
WD40 70 109 1.28e-11 SMART
WD40 112 151 4.87e-12 SMART
WD40 154 193 5.22e-12 SMART
WD40 196 236 1.21e-7 SMART
WD40 239 281 5.47e-6 SMART
WD40 284 325 1.01e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232390
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a protein containing several WD40 repeats. WD repeats are approximately 30- to 40-amino acid domains containing several conserved residues, including a trp-asp at the C-terminal end. The encoded protein may mediate protein-protein interactions. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 C T 17: 43,426,334 T218I probably damaging Het
Adgrv1 C A 13: 81,397,465 S5567I possibly damaging Het
Alpk1 T C 3: 127,681,164 T397A probably benign Het
Atp9a T A 2: 168,639,988 Y880F possibly damaging Het
Celsr1 T C 15: 85,930,546 T1905A probably benign Het
Chd8 G A 14: 52,205,125 A656V possibly damaging Het
Dffa A G 4: 149,117,934 N265S probably benign Het
Frrs1 A G 3: 116,880,896 D109G probably benign Het
Gm20821 A T Y: 9,783,963 K195M probably damaging Het
Ifi207 A T 1: 173,730,304 N289K unknown Het
Kank1 T C 19: 25,411,305 F781L probably benign Het
Lrba A T 3: 86,325,022 M759L possibly damaging Het
Lrp8 A G 4: 107,854,321 Y307C probably damaging Het
Neb T C 2: 52,147,156 H6847R probably damaging Het
Olfr599 T C 7: 103,338,501 V149A probably benign Het
Olfr703 G A 7: 106,844,695 C28Y probably benign Het
Pcdha5 C A 18: 36,961,702 Y421* probably null Het
Pclo T A 5: 14,540,717 D1010E unknown Het
Pld2 A T 11: 70,552,759 D449V probably damaging Het
Ppfia1 C A 7: 144,485,095 M1032I possibly damaging Het
Prickle2 C A 6: 92,376,210 L758F probably damaging Het
Sarm1 A G 11: 78,483,476 V564A probably damaging Het
Taf1b C A 12: 24,549,438 F398L probably benign Het
Tll2 A G 19: 41,117,257 I361T possibly damaging Het
Tmem260 T C 14: 48,505,259 V517A probably benign Het
Usp24 A G 4: 106,341,214 K106E probably benign Het
Vcan C A 13: 89,690,286 V2380F probably benign Het
Vmn2r65 A G 7: 84,946,334 S381P probably damaging Het
Vmn2r73 T C 7: 85,857,947 D719G probably damaging Het
Wdr7 G T 18: 63,987,312 V1475F probably benign Het
Ythdc2 A G 18: 44,860,621 D911G probably damaging Het
Zbtb32 T A 7: 30,590,204 E11V probably damaging Het
Zfp563 T G 17: 33,104,838 Y136D probably damaging Het
Other mutations in Wdr5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02394:Wdr5b APN 16 36042263 missense probably damaging 1.00
R0605:Wdr5b UTSW 16 36041996 missense probably benign 0.00
R0627:Wdr5b UTSW 16 36042470 missense probably benign 0.07
R5977:Wdr5b UTSW 16 36042004 missense probably damaging 1.00
R6899:Wdr5b UTSW 16 36041780 missense probably damaging 1.00
R7236:Wdr5b UTSW 16 36041838 missense possibly damaging 0.88
R7246:Wdr5b UTSW 16 36041936 missense probably damaging 1.00
R7641:Wdr5b UTSW 16 36042342 missense probably damaging 1.00
R8063:Wdr5b UTSW 16 36041788 missense possibly damaging 0.78
Z1088:Wdr5b UTSW 16 36042443 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTCAGACTTACTCTTGCGGG -3'
(R):5'- GTGCAGACAAAGTCTTGAGGC -3'

Sequencing Primer
(F):5'- ATTTAGTCCTAATGGCGAATGGC -3'
(R):5'- CAGACAAAGTCTTGAGGCATTTTCC -3'
Posted On2016-07-22