Incidental Mutation 'R5280:Gm20821'
ID404186
Institutional Source Beutler Lab
Gene Symbol Gm20821
Ensembl Gene ENSMUSG00000094556
Gene Namepredicted gene, 20821
Synonyms
MMRRC Submission 042840-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R5280 (G1)
Quality Score83.5
Status Not validated
ChromosomeY
Chromosomal Location9781804-9784197 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 9783963 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 195 (K195M)
Ref Sequence ENSEMBL: ENSMUSP00000137322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179829] [ENSMUST00000180352]
Predicted Effect probably damaging
Transcript: ENSMUST00000179829
AA Change: K195M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136629
Gene: ENSMUSG00000094556
AA Change: K195M

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Spin-Ssty 21 70 3.3e-24 PFAM
Pfam:Spin-Ssty 100 149 1.4e-24 PFAM
Pfam:Spin-Ssty 178 223 2.5e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000180352
AA Change: K195M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137322
Gene: ENSMUSG00000094556
AA Change: K195M

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Spin-Ssty 21 70 1.2e-23 PFAM
Pfam:Spin-Ssty 100 149 2e-23 PFAM
Pfam:Spin-Ssty 178 223 1.2e-17 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 C T 17: 43,426,334 T218I probably damaging Het
Adgrv1 C A 13: 81,397,465 S5567I possibly damaging Het
Alpk1 T C 3: 127,681,164 T397A probably benign Het
Atp9a T A 2: 168,639,988 Y880F possibly damaging Het
Celsr1 T C 15: 85,930,546 T1905A probably benign Het
Chd8 G A 14: 52,205,125 A656V possibly damaging Het
Dffa A G 4: 149,117,934 N265S probably benign Het
Frrs1 A G 3: 116,880,896 D109G probably benign Het
Ifi207 A T 1: 173,730,304 N289K unknown Het
Kank1 T C 19: 25,411,305 F781L probably benign Het
Lrba A T 3: 86,325,022 M759L possibly damaging Het
Lrp8 A G 4: 107,854,321 Y307C probably damaging Het
Neb T C 2: 52,147,156 H6847R probably damaging Het
Olfr599 T C 7: 103,338,501 V149A probably benign Het
Olfr703 G A 7: 106,844,695 C28Y probably benign Het
Pcdha5 C A 18: 36,961,702 Y421* probably null Het
Pclo T A 5: 14,540,717 D1010E unknown Het
Pld2 A T 11: 70,552,759 D449V probably damaging Het
Ppfia1 C A 7: 144,485,095 M1032I possibly damaging Het
Prickle2 C A 6: 92,376,210 L758F probably damaging Het
Sarm1 A G 11: 78,483,476 V564A probably damaging Het
Taf1b C A 12: 24,549,438 F398L probably benign Het
Tll2 A G 19: 41,117,257 I361T possibly damaging Het
Tmem260 T C 14: 48,505,259 V517A probably benign Het
Usp24 A G 4: 106,341,214 K106E probably benign Het
Vcan C A 13: 89,690,286 V2380F probably benign Het
Vmn2r65 A G 7: 84,946,334 S381P probably damaging Het
Vmn2r73 T C 7: 85,857,947 D719G probably damaging Het
Wdr5b T C 16: 36,041,832 V107A probably benign Het
Wdr7 G T 18: 63,987,312 V1475F probably benign Het
Ythdc2 A G 18: 44,860,621 D911G probably damaging Het
Zbtb32 T A 7: 30,590,204 E11V probably damaging Het
Zfp563 T G 17: 33,104,838 Y136D probably damaging Het
Other mutations in Gm20821
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1986:Gm20821 UTSW Y 9783927 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AGGTGCCATTCTTACAGGAC -3'
(R):5'- AGGTTGTCAAAGACCCATAGG -3'

Sequencing Primer
(F):5'- ATTTCCTACAAGAAGGATCCGGTC -3'
(R):5'- GACACCAGAGTATAGACATAG -3'
Posted On2016-07-22