Incidental Mutation 'R4755:Fhad1'
ID 404192
Institutional Source Beutler Lab
Gene Symbol Fhad1
Ensembl Gene ENSMUSG00000051435
Gene Name forkhead-associated phosphopeptide binding domain 1
Synonyms 2900090M10Rik
MMRRC Submission 042033-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R4755 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 141617749-141742393 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 141655794 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 105 (I105N)
Ref Sequence ENSEMBL: ENSMUSP00000036224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036701] [ENSMUST00000105779] [ENSMUST00000105780]
AlphaFold A6PWD2
Predicted Effect probably damaging
Transcript: ENSMUST00000036701
AA Change: I105N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036224
Gene: ENSMUSG00000051435
AA Change: I105N

DomainStartEndE-ValueType
coiled coil region 31 250 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105779
AA Change: I770N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101405
Gene: ENSMUSG00000051435
AA Change: I770N

DomainStartEndE-ValueType
FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105780
AA Change: I770N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101406
Gene: ENSMUSG00000051435
AA Change: I770N

DomainStartEndE-ValueType
FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129192
Meta Mutation Damage Score 0.0923 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (112/117)
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik T A 3: 59,733,280 (GRCm39) noncoding transcript Het
Aadacl2fm1 C T 3: 59,843,735 (GRCm39) A143V probably benign Het
Accs T C 2: 93,671,682 (GRCm39) E236G probably damaging Het
Agrn C T 4: 156,257,979 (GRCm39) probably benign Het
Ahi1 A G 10: 20,930,946 (GRCm39) I929V possibly damaging Het
Akap5 C A 12: 76,374,581 (GRCm39) C4* probably null Het
Amotl2 A T 9: 102,597,679 (GRCm39) H146L probably damaging Het
Ank1 A G 8: 23,594,990 (GRCm39) N666S probably damaging Het
Atp10d A T 5: 72,403,509 (GRCm39) T373S probably benign Het
Bpifb9b T A 2: 154,161,614 (GRCm39) M582K probably benign Het
Brca2 T A 5: 150,483,452 (GRCm39) probably null Het
Ccdc149 A G 5: 52,561,493 (GRCm39) V229A probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Cdk5rap2 A G 4: 70,156,662 (GRCm39) S1617P probably damaging Het
Cenpk A T 13: 104,367,379 (GRCm39) M37L probably benign Het
Cenpk A T 13: 104,386,020 (GRCm39) H305L probably benign Het
Ces5a C A 8: 94,262,305 (GRCm39) A11S probably benign Het
Cfap65 T C 1: 74,967,520 (GRCm39) E186G probably damaging Het
Cfh T A 1: 140,016,546 (GRCm39) I593F probably damaging Het
Clstn2 C T 9: 97,327,726 (GRCm39) V961I probably benign Het
Cog5 T A 12: 31,919,405 (GRCm39) probably null Het
Col4a4 T C 1: 82,518,895 (GRCm39) D100G unknown Het
Cyp3a41a T C 5: 145,652,316 (GRCm39) D61G probably damaging Het
Dnah10 A G 5: 124,824,809 (GRCm39) N655S probably benign Het
Dnai1 C G 4: 41,610,269 (GRCm39) T295R probably damaging Het
Dnajc6 C T 4: 101,407,996 (GRCm39) A44V probably damaging Het
Eif4enif1 A T 11: 3,194,016 (GRCm39) D960V probably damaging Het
Fam167b C T 4: 129,472,135 (GRCm39) G12R probably damaging Het
Fam20b A T 1: 156,515,066 (GRCm39) Y266* probably null Het
Fer1l6 T A 15: 58,512,060 (GRCm39) V1509D probably benign Het
Fmo2 T C 1: 162,716,374 (GRCm39) D71G probably damaging Het
Folr2 T C 7: 101,493,006 (GRCm39) T6A possibly damaging Het
Fry A C 5: 150,321,719 (GRCm39) E1018A probably damaging Het
Gas2l2 A G 11: 83,320,193 (GRCm39) I21T probably damaging Het
Gfra1 T C 19: 58,441,676 (GRCm39) Y85C probably damaging Het
Gpld1 A T 13: 25,163,671 (GRCm39) Y43F probably benign Het
Gpld1 T A 13: 25,163,675 (GRCm39) Y44* probably null Het
Grid2 A G 6: 63,885,972 (GRCm39) T123A probably benign Het
Grina T C 15: 76,133,442 (GRCm39) L305P probably damaging Het
Gucy1a1 G A 3: 82,002,102 (GRCm39) A659V probably benign Het
H2-T10 T A 17: 36,429,837 (GRCm39) K319* probably null Het
Hey2 A T 10: 30,710,300 (GRCm39) V151E probably benign Het
Ighv1-69 G A 12: 115,587,178 (GRCm39) T13I probably benign Het
Il1rap C A 16: 26,541,532 (GRCm39) A591E probably benign Het
Ildr1 T C 16: 36,542,383 (GRCm39) L261P probably benign Het
Jak1 A G 4: 101,031,354 (GRCm39) Y463H probably damaging Het
Lrp1b T C 2: 41,159,285 (GRCm39) I1666V probably benign Het
Lrp1b T A 2: 41,361,028 (GRCm39) T592S probably benign Het
Lrrc36 A G 8: 106,178,776 (GRCm39) T445A possibly damaging Het
Ly9 G A 1: 171,434,806 (GRCm39) S29F probably damaging Het
Mapk7 A C 11: 61,381,669 (GRCm39) C32W probably damaging Het
Marchf10 C T 11: 105,255,302 (GRCm39) probably benign Het
Mier2 A T 10: 79,385,031 (GRCm39) M119K probably damaging Het
Mpv17 A T 5: 31,303,326 (GRCm39) C59* probably null Het
Mrpl27 G A 11: 94,544,659 (GRCm39) probably benign Het
Myo18b G A 5: 113,022,340 (GRCm39) Q351* probably null Het
Myo1a A G 10: 127,551,557 (GRCm39) I704M probably damaging Het
Nadsyn1 A G 7: 143,360,650 (GRCm39) C373R probably damaging Het
Nckipsd C A 9: 108,691,938 (GRCm39) A513E probably benign Het
Neb T C 2: 52,110,221 (GRCm39) D209G probably damaging Het
Nkapl T A 13: 21,652,457 (GRCm39) Q52L unknown Het
Nptx2 G A 5: 144,483,250 (GRCm39) S126N probably benign Het
Or2a7 G A 6: 43,150,977 (GRCm39) S19N probably benign Het
Or52d3 T A 7: 104,229,268 (GRCm39) Y138* probably null Het
Or7g17 A T 9: 18,768,476 (GRCm39) H185L probably benign Het
Or8b52 A G 9: 38,577,128 (GRCm39) V4A probably benign Het
Pclo A T 5: 14,764,362 (GRCm39) R4278S unknown Het
Pcnx1 T G 12: 81,997,068 (GRCm39) L988R probably damaging Het
Prl2c5 C A 13: 13,363,970 (GRCm39) N75K probably benign Het
Prpf19 T G 19: 10,875,154 (GRCm39) probably benign Het
Ralgapa1 A G 12: 55,759,533 (GRCm39) S997P probably damaging Het
Rangap1 T C 15: 81,597,118 (GRCm39) T226A probably benign Het
Rimklb G A 6: 122,433,365 (GRCm39) L262F probably damaging Het
Rnf169 A G 7: 99,574,930 (GRCm39) M555T probably benign Het
Rp1l1 A T 14: 64,267,519 (GRCm39) D1035V probably benign Het
Rps23rg1 A T 8: 3,633,922 (GRCm39) S8C probably damaging Het
Scd2 T A 19: 44,289,791 (GRCm39) L262Q probably damaging Het
Scgb2b12 T A 7: 32,024,956 (GRCm39) M84L probably benign Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Sipa1l1 G A 12: 82,419,160 (GRCm39) V613I possibly damaging Het
Slc25a23 T A 17: 57,359,794 (GRCm39) D67V possibly damaging Het
Slc25a39 C T 11: 102,297,492 (GRCm39) probably benign Het
Slc4a10 T A 2: 62,127,332 (GRCm39) F895Y probably damaging Het
Slc5a4a A C 10: 76,022,398 (GRCm39) K578Q probably benign Het
Slc6a13 G A 6: 121,302,008 (GRCm39) G197S probably damaging Het
Smarca2 A T 19: 26,631,883 (GRCm39) E566V possibly damaging Het
Sorbs3 A T 14: 70,421,548 (GRCm39) N594K probably benign Het
Spata22 A T 11: 73,236,582 (GRCm39) D296V probably damaging Het
Sphk2 G A 7: 45,363,058 (GRCm39) A11V possibly damaging Het
Spp1 A T 5: 104,583,081 (GRCm39) probably benign Het
Strn3 T A 12: 51,656,999 (GRCm39) I760L possibly damaging Het
Syk A T 13: 52,796,022 (GRCm39) Y539F probably benign Het
Tdpoz9-ps1 T C 3: 93,846,093 (GRCm39) probably null Het
Thsd7b T A 1: 130,138,001 (GRCm39) Y1560N probably benign Het
Tmod2 C A 9: 75,504,494 (GRCm39) E42* probably null Het
Tom1l1 T C 11: 90,575,942 (GRCm39) E30G probably damaging Het
Trav10 G A 14: 53,743,518 (GRCm39) A40T probably benign Het
Trav14-2 G A 14: 53,878,237 (GRCm39) probably benign Het
Tril T A 6: 53,795,449 (GRCm39) E591V probably damaging Het
Trp53bp1 T A 2: 121,059,087 (GRCm39) R179* probably null Het
Tspoap1 A T 11: 87,662,489 (GRCm39) D562V possibly damaging Het
Usp44 A T 10: 93,682,768 (GRCm39) H406L probably damaging Het
Vangl1 A G 3: 102,065,608 (GRCm39) I509T probably benign Het
Vax2 T G 6: 83,688,379 (GRCm39) L34W probably damaging Het
Vmn1r55 A T 7: 5,150,025 (GRCm39) C133S probably damaging Het
Vmn2r8 T A 5: 108,949,566 (GRCm39) D427V probably benign Het
Vwde A G 6: 13,205,851 (GRCm39) I232T possibly damaging Het
Wnk1 C A 6: 119,940,431 (GRCm39) A769S probably damaging Het
Xpo4 A C 14: 57,855,638 (GRCm39) S264A probably benign Het
Zfp330 A T 8: 83,496,015 (GRCm39) C75* probably null Het
Zfp526 T A 7: 24,925,064 (GRCm39) L441Q probably benign Het
Zfp607b T G 7: 27,402,930 (GRCm39) L462R probably damaging Het
Zfp719 T A 7: 43,240,217 (GRCm39) F602I probably damaging Het
Other mutations in Fhad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Fhad1 APN 4 141,632,923 (GRCm39) missense probably benign 0.02
IGL01478:Fhad1 APN 4 141,678,949 (GRCm39) missense possibly damaging 0.84
IGL01752:Fhad1 APN 4 141,700,210 (GRCm39) missense possibly damaging 0.82
IGL01788:Fhad1 APN 4 141,660,113 (GRCm39) missense probably benign 0.00
IGL01919:Fhad1 APN 4 141,691,906 (GRCm39) missense probably damaging 0.96
IGL02489:Fhad1 APN 4 141,684,931 (GRCm39) missense probably damaging 0.97
IGL02568:Fhad1 APN 4 141,660,105 (GRCm39) missense probably null 1.00
IGL02583:Fhad1 APN 4 141,738,955 (GRCm39) utr 5 prime probably benign
IGL02716:Fhad1 APN 4 141,645,642 (GRCm39) missense possibly damaging 0.89
IGL02819:Fhad1 APN 4 141,646,069 (GRCm39) missense probably benign 0.23
IGL02820:Fhad1 APN 4 141,646,069 (GRCm39) missense probably benign 0.23
IGL03038:Fhad1 APN 4 141,729,805 (GRCm39) missense probably benign 0.38
IGL03167:Fhad1 APN 4 141,700,108 (GRCm39) missense probably benign 0.00
IGL03255:Fhad1 APN 4 141,700,191 (GRCm39) missense possibly damaging 0.79
R4466_Fhad1_343 UTSW 4 141,684,969 (GRCm39) missense probably damaging 1.00
R4831_Fhad1_494 UTSW 4 141,643,378 (GRCm39) splice site probably null
R5504_Fhad1_818 UTSW 4 141,712,846 (GRCm39) missense probably benign
BB002:Fhad1 UTSW 4 141,681,498 (GRCm39) missense probably damaging 0.97
BB012:Fhad1 UTSW 4 141,681,498 (GRCm39) missense probably damaging 0.97
PIT1430001:Fhad1 UTSW 4 141,637,060 (GRCm39) missense probably damaging 0.99
R0014:Fhad1 UTSW 4 141,655,719 (GRCm39) missense probably damaging 1.00
R0116:Fhad1 UTSW 4 141,667,406 (GRCm39) missense probably benign 0.06
R0143:Fhad1 UTSW 4 141,656,957 (GRCm39) splice site probably benign
R0178:Fhad1 UTSW 4 141,682,651 (GRCm39) missense probably benign 0.31
R0308:Fhad1 UTSW 4 141,712,904 (GRCm39) splice site probably benign
R0384:Fhad1 UTSW 4 141,729,737 (GRCm39) missense probably benign
R0583:Fhad1 UTSW 4 141,631,301 (GRCm39) missense probably benign 0.37
R1501:Fhad1 UTSW 4 141,691,936 (GRCm39) missense probably benign
R1584:Fhad1 UTSW 4 141,712,822 (GRCm39) missense probably benign 0.22
R1615:Fhad1 UTSW 4 141,649,634 (GRCm39) missense probably damaging 0.99
R1991:Fhad1 UTSW 4 141,709,473 (GRCm39) missense possibly damaging 0.75
R2060:Fhad1 UTSW 4 141,626,560 (GRCm39) missense probably benign 0.08
R2079:Fhad1 UTSW 4 141,718,513 (GRCm39) nonsense probably null
R2133:Fhad1 UTSW 4 141,655,711 (GRCm39) missense probably damaging 1.00
R2337:Fhad1 UTSW 4 141,649,655 (GRCm39) missense possibly damaging 0.84
R2843:Fhad1 UTSW 4 141,632,279 (GRCm39) missense probably benign 0.06
R2844:Fhad1 UTSW 4 141,632,279 (GRCm39) missense probably benign 0.06
R2845:Fhad1 UTSW 4 141,632,279 (GRCm39) missense probably benign 0.06
R2846:Fhad1 UTSW 4 141,632,279 (GRCm39) missense probably benign 0.06
R2866:Fhad1 UTSW 4 141,648,099 (GRCm39) missense probably benign 0.00
R3119:Fhad1 UTSW 4 141,645,618 (GRCm39) frame shift probably null
R3760:Fhad1 UTSW 4 141,637,124 (GRCm39) missense probably damaging 1.00
R4180:Fhad1 UTSW 4 141,712,854 (GRCm39) missense possibly damaging 0.69
R4466:Fhad1 UTSW 4 141,684,969 (GRCm39) missense probably damaging 1.00
R4627:Fhad1 UTSW 4 141,623,779 (GRCm39) missense possibly damaging 0.47
R4680:Fhad1 UTSW 4 141,738,858 (GRCm39) nonsense probably null
R4725:Fhad1 UTSW 4 141,655,689 (GRCm39) critical splice donor site probably null
R4831:Fhad1 UTSW 4 141,643,378 (GRCm39) splice site probably null
R4909:Fhad1 UTSW 4 141,712,822 (GRCm39) missense probably benign 0.01
R4968:Fhad1 UTSW 4 141,645,618 (GRCm39) missense probably damaging 1.00
R5004:Fhad1 UTSW 4 141,729,910 (GRCm39) critical splice acceptor site probably null
R5036:Fhad1 UTSW 4 141,648,052 (GRCm39) missense probably benign 0.03
R5048:Fhad1 UTSW 4 141,691,987 (GRCm39) critical splice acceptor site probably null
R5416:Fhad1 UTSW 4 141,646,113 (GRCm39) missense probably benign 0.39
R5504:Fhad1 UTSW 4 141,712,846 (GRCm39) missense probably benign
R5586:Fhad1 UTSW 4 141,632,442 (GRCm39) missense probably benign 0.44
R5692:Fhad1 UTSW 4 141,690,768 (GRCm39) missense probably benign 0.00
R5706:Fhad1 UTSW 4 141,681,427 (GRCm39) missense probably damaging 1.00
R5773:Fhad1 UTSW 4 141,656,881 (GRCm39) missense probably damaging 0.99
R5823:Fhad1 UTSW 4 141,682,617 (GRCm39) missense possibly damaging 0.84
R5833:Fhad1 UTSW 4 141,729,838 (GRCm39) missense probably damaging 1.00
R6170:Fhad1 UTSW 4 141,618,263 (GRCm39) nonsense probably null
R6286:Fhad1 UTSW 4 141,648,209 (GRCm39) missense probably damaging 1.00
R6610:Fhad1 UTSW 4 141,643,707 (GRCm39) missense possibly damaging 0.94
R6755:Fhad1 UTSW 4 141,691,915 (GRCm39) missense probably damaging 1.00
R7006:Fhad1 UTSW 4 141,645,602 (GRCm39) frame shift probably null
R7008:Fhad1 UTSW 4 141,645,602 (GRCm39) frame shift probably null
R7012:Fhad1 UTSW 4 141,645,602 (GRCm39) frame shift probably null
R7014:Fhad1 UTSW 4 141,645,602 (GRCm39) frame shift probably null
R7058:Fhad1 UTSW 4 141,645,602 (GRCm39) frame shift probably null
R7059:Fhad1 UTSW 4 141,645,602 (GRCm39) frame shift probably null
R7060:Fhad1 UTSW 4 141,645,602 (GRCm39) frame shift probably null
R7159:Fhad1 UTSW 4 141,678,927 (GRCm39) missense probably benign 0.01
R7472:Fhad1 UTSW 4 141,691,937 (GRCm39) missense probably benign
R7670:Fhad1 UTSW 4 141,678,802 (GRCm39) missense probably benign 0.01
R7694:Fhad1 UTSW 4 141,632,375 (GRCm39) missense probably benign 0.41
R7745:Fhad1 UTSW 4 141,618,250 (GRCm39) missense probably benign 0.00
R7848:Fhad1 UTSW 4 141,632,913 (GRCm39) missense probably benign 0.29
R7853:Fhad1 UTSW 4 141,637,134 (GRCm39) missense probably damaging 0.99
R7867:Fhad1 UTSW 4 141,632,902 (GRCm39) missense probably benign 0.00
R7925:Fhad1 UTSW 4 141,681,498 (GRCm39) missense probably damaging 0.97
R8089:Fhad1 UTSW 4 141,684,971 (GRCm39) missense probably damaging 1.00
R8123:Fhad1 UTSW 4 141,712,836 (GRCm39) missense probably benign 0.02
R8711:Fhad1 UTSW 4 141,684,924 (GRCm39) missense probably benign 0.25
R8751:Fhad1 UTSW 4 141,646,134 (GRCm39) missense probably benign 0.04
R8783:Fhad1 UTSW 4 141,636,403 (GRCm39) missense probably benign 0.02
R8858:Fhad1 UTSW 4 141,666,339 (GRCm39) missense possibly damaging 0.87
R8867:Fhad1 UTSW 4 141,656,885 (GRCm39) missense probably damaging 0.97
R8890:Fhad1 UTSW 4 141,656,902 (GRCm39) missense probably benign 0.01
R8982:Fhad1 UTSW 4 141,729,895 (GRCm39) missense probably damaging 1.00
R9004:Fhad1 UTSW 4 141,649,735 (GRCm39) splice site probably benign
R9021:Fhad1 UTSW 4 141,709,620 (GRCm39) missense probably damaging 0.97
R9190:Fhad1 UTSW 4 141,646,058 (GRCm39) critical splice donor site probably null
R9237:Fhad1 UTSW 4 141,632,483 (GRCm39) missense probably benign 0.11
R9614:Fhad1 UTSW 4 141,678,882 (GRCm39) missense possibly damaging 0.69
R9744:Fhad1 UTSW 4 141,637,124 (GRCm39) missense probably damaging 1.00
X0018:Fhad1 UTSW 4 141,678,927 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTAAGTGGGAGCATCAAGC -3'
(R):5'- TGGTCTTGATGGTGACTCAC -3'

Sequencing Primer
(F):5'- GCATCAAGCCACAGAGACGG -3'
(R):5'- CCATTATCATCATGGCGGGAG -3'
Posted On 2016-07-22