Incidental Mutation 'R4794:Exoc5'
ID 404200
Institutional Source Beutler Lab
Gene Symbol Exoc5
Ensembl Gene ENSMUSG00000061244
Gene Name exocyst complex component 5
Synonyms Sec10l1, SEC10, PRO1912
MMRRC Submission 042420-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock # R4794 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 49004090-49066653 bp(-) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) T to C at 49048900 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161504] [ENSMUST00000162175]
AlphaFold Q3TPX4
Predicted Effect probably benign
Transcript: ENSMUST00000160386
SMART Domains Protein: ENSMUSP00000123825
Gene: ENSMUSG00000061244

DomainStartEndE-ValueType
Pfam:Sec10 2 76 2.4e-18 PFAM
Pfam:Sec10 71 200 2.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161504
SMART Domains Protein: ENSMUSP00000124012
Gene: ENSMUSG00000061244

DomainStartEndE-ValueType
Pfam:Sec10 43 175 9.5e-24 PFAM
Pfam:Sec10 175 642 1.1e-119 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000162175
SMART Domains Protein: ENSMUSP00000125434
Gene: ENSMUSG00000061244

DomainStartEndE-ValueType
Pfam:Sec10 89 707 6.6e-154 PFAM
Meta Mutation Damage Score 0.9502 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. The complex is also essential for the biogenesis of epithelial cell surface polarity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in all cells die prior to E8.5. Mice homozygous for a conditional allele activated in kidney cells exhibit ureteropelvic junction obstructions leading to neontal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,421,424 I141K probably damaging Het
Adgrb1 A G 15: 74,588,129 E537G probably damaging Het
Asic3 C T 5: 24,415,897 A259V probably damaging Het
Bcar1 G A 8: 111,720,920 Q142* probably null Het
Bcas3 T C 11: 85,509,468 V200A probably damaging Het
Cd302 A T 2: 60,272,149 I42N probably benign Het
Colec12 C A 18: 9,848,984 N387K probably damaging Het
Copa T A 1: 172,119,321 I1032N probably damaging Het
D630003M21Rik G C 2: 158,196,139 T1129S probably benign Het
D630045J12Rik G A 6: 38,194,485 T916I possibly damaging Het
Dnajb13 C T 7: 100,503,992 A241T probably damaging Het
Dyrk4 G T 6: 126,885,337 N397K possibly damaging Het
Eftud2 T A 11: 102,870,177 Y114F probably benign Het
Epm2a A G 10: 11,390,853 D114G probably benign Het
Fam135a G A 1: 24,029,160 T706I probably benign Het
Fasn A G 11: 120,811,295 V1845A probably benign Het
Fscn3 A G 6: 28,430,596 E255G probably damaging Het
Galnt7 A T 8: 57,545,363 Y311N probably damaging Het
Gm13757 A T 2: 88,446,347 M197K probably benign Het
Gm5724 A G 6: 141,767,562 V31A probably benign Het
Gm8765 C G 13: 50,703,239 P971R probably benign Het
Grid1 T C 14: 34,822,622 L50P probably damaging Het
Hepacam2 A G 6: 3,475,933 F331L probably damaging Het
Ikbkap ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 4: 56,781,176 probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif1a T C 1: 93,025,727 Y1245C probably damaging Het
Ltbp3 T C 19: 5,756,679 F1022L probably damaging Het
Med16 G T 10: 79,900,117 T399N probably damaging Het
Mfsd14a A T 3: 116,645,506 probably benign Het
Myh7b G A 2: 155,623,266 V681I probably benign Het
Ndc1 A G 4: 107,390,222 E409G probably benign Het
Necap2 A G 4: 141,071,601 probably benign Het
Olfr47 T A 6: 43,235,695 L29H probably damaging Het
Olfr847 C T 9: 19,375,545 S112N probably benign Het
Parp12 G A 6: 39,117,810 T117I probably benign Het
Pars2 C A 4: 106,654,210 C396* probably null Het
Prg4 A T 1: 150,454,546 probably benign Het
Prkg2 G A 5: 98,966,633 T523I probably damaging Het
Prph T A 15: 99,057,427 L425Q probably damaging Het
Ranbp9 A G 13: 43,414,076 Y549H probably damaging Het
Rbm12 A T 2: 156,095,569 probably benign Het
Reln T C 5: 22,344,185 Y75C probably damaging Het
Rock2 G A 12: 16,940,407 R110H probably damaging Het
Samd1 G A 8: 83,999,717 E468K probably damaging Het
Samd11 T A 4: 156,249,465 Q173L probably damaging Het
Scgb2b20 C A 7: 33,365,726 G37V probably damaging Het
Sf1 C A 19: 6,375,664 probably benign Het
Slc17a5 T A 9: 78,574,715 H183L probably damaging Het
Smgc T A 15: 91,841,454 S13T probably benign Het
Snapin A G 3: 90,490,785 probably benign Het
Ssc5d C T 7: 4,943,745 P1033S probably benign Het
Strn3 T C 12: 51,650,171 E259G probably benign Het
Tbc1d32 A G 10: 56,196,836 F238L possibly damaging Het
Tbck G A 3: 132,686,968 V57M possibly damaging Het
Tgm3 A G 2: 130,041,955 D511G probably benign Het
Tlr5 T C 1: 182,973,896 V241A probably benign Het
Tmem181c-ps A G 17: 6,620,355 noncoding transcript Het
Tnfrsf1a G A 6: 125,358,084 C168Y probably damaging Het
Tph2 G T 10: 115,182,770 L79I possibly damaging Het
Tsc1 G A 2: 28,661,690 probably null Het
Ttc14 A T 3: 33,803,149 M215L probably benign Het
Ube3c A G 5: 29,597,085 N120S probably benign Het
Ubr2 A T 17: 46,930,445 W1728R probably damaging Het
Vnn1 A G 10: 23,900,704 T318A probably benign Het
Washc2 T C 6: 116,258,649 V941A probably benign Het
Wdfy3 A G 5: 101,943,943 V510A probably damaging Het
Wdsub1 A T 2: 59,862,844 V272E possibly damaging Het
Xylt1 A C 7: 117,637,635 D537A probably benign Het
Zfp57 A G 17: 37,010,130 N292S possibly damaging Het
Other mutations in Exoc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Exoc5 APN 14 49037755 missense probably damaging 1.00
IGL01473:Exoc5 APN 14 49014294 missense possibly damaging 0.83
IGL01599:Exoc5 APN 14 49034964 missense probably benign 0.00
IGL01702:Exoc5 APN 14 49015615 nonsense probably null
IGL02173:Exoc5 APN 14 49034801 splice site probably benign
IGL02211:Exoc5 APN 14 49014210 missense probably damaging 1.00
IGL02874:Exoc5 APN 14 49051446 missense probably benign 0.02
IGL02968:Exoc5 APN 14 49033269 critical splice donor site probably null
IGL03167:Exoc5 APN 14 49051345 missense probably damaging 1.00
IGL03207:Exoc5 APN 14 49033375 missense probably benign
PIT4260001:Exoc5 UTSW 14 49048765 missense probably benign 0.01
R0139:Exoc5 UTSW 14 49036036 missense probably damaging 1.00
R0594:Exoc5 UTSW 14 49036087 splice site probably benign
R0945:Exoc5 UTSW 14 49039342 splice site probably benign
R1968:Exoc5 UTSW 14 49034890 missense probably benign 0.27
R2082:Exoc5 UTSW 14 49015587 missense probably benign 0.07
R2186:Exoc5 UTSW 14 49015479 missense probably benign 0.08
R2356:Exoc5 UTSW 14 49016281 missense probably benign 0.00
R3419:Exoc5 UTSW 14 49023278 missense probably damaging 1.00
R3743:Exoc5 UTSW 14 49014349 missense probably benign 0.00
R3743:Exoc5 UTSW 14 49033407 nonsense probably null
R3870:Exoc5 UTSW 14 49019396 splice site probably benign
R4273:Exoc5 UTSW 14 49015480 nonsense probably null
R4853:Exoc5 UTSW 14 49052369 small deletion probably benign
R4864:Exoc5 UTSW 14 49052382 missense probably benign 0.00
R4883:Exoc5 UTSW 14 49052364 missense probably damaging 1.00
R5098:Exoc5 UTSW 14 49048847 missense possibly damaging 0.90
R5965:Exoc5 UTSW 14 49034931 missense probably damaging 1.00
R6036:Exoc5 UTSW 14 49014322 missense possibly damaging 0.82
R6036:Exoc5 UTSW 14 49014322 missense possibly damaging 0.82
R6820:Exoc5 UTSW 14 49048930 splice site probably null
R8473:Exoc5 UTSW 14 49019403 missense probably null 0.98
R8987:Exoc5 UTSW 14 49015529 missense probably damaging 1.00
R9229:Exoc5 UTSW 14 49014253 nonsense probably null
R9250:Exoc5 UTSW 14 49019458 missense probably damaging 1.00
R9340:Exoc5 UTSW 14 49048840 missense probably damaging 0.98
R9381:Exoc5 UTSW 14 49037737 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCAATGCTTACCTTTTCAG -3'
(R):5'- GTGGTATCAAAGTTAGAAGCTTGG -3'

Sequencing Primer
(F):5'- GGCAATGCTTACCTTTTCAGAATTTG -3'
(R):5'- TCAAAGTTAGAAGCTTGGTTAAGAG -3'
Posted On 2016-07-22