Incidental Mutation 'R4837:Hnrnpl'
ID404215
Institutional Source Beutler Lab
Gene Symbol Hnrnpl
Ensembl Gene ENSMUSG00000015165
Gene Nameheterogeneous nuclear ribonucleoprotein L
SynonymsHnrpl, D830027H13Rik
MMRRC Submission 042452-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4837 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location28808541-28822266 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28817337 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 184 (S184P)
Ref Sequence ENSEMBL: ENSMUSP00000133952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038572] [ENSMUST00000172529] [ENSMUST00000172884] [ENSMUST00000174548] [ENSMUST00000174882]
Predicted Effect probably benign
Transcript: ENSMUST00000038572
SMART Domains Protein: ENSMUSP00000049407
Gene: ENSMUSG00000015165

DomainStartEndE-ValueType
low complexity region 3 57 N/A INTRINSIC
low complexity region 71 86 N/A INTRINSIC
RRM 100 169 9.8e-9 SMART
RRM 191 261 4.75e-7 SMART
low complexity region 314 339 N/A INTRINSIC
low complexity region 356 374 N/A INTRINSIC
RRM 380 449 5.09e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172529
SMART Domains Protein: ENSMUSP00000133932
Gene: ENSMUSG00000015165

DomainStartEndE-ValueType
Blast:RRM 1 39 9e-20 BLAST
RRM 61 131 4.75e-7 SMART
low complexity region 184 209 N/A INTRINSIC
low complexity region 226 244 N/A INTRINSIC
RRM 250 319 5.09e-7 SMART
Blast:RRM_2 369 442 6e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172841
Predicted Effect probably benign
Transcript: ENSMUST00000172884
SMART Domains Protein: ENSMUSP00000134271
Gene: ENSMUSG00000015165

DomainStartEndE-ValueType
Blast:RRM 1 39 1e-21 BLAST
SCOP:d1qm9a1 3 61 3e-3 SMART
Pfam:RRM_6 67 113 5.7e-5 PFAM
Pfam:RRM_1 70 113 1.3e-5 PFAM
Pfam:RRM_5 78 113 9.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173578
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174396
Predicted Effect probably benign
Transcript: ENSMUST00000174477
SMART Domains Protein: ENSMUSP00000134734
Gene: ENSMUSG00000015165

DomainStartEndE-ValueType
low complexity region 4 49 N/A INTRINSIC
low complexity region 63 78 N/A INTRINSIC
RRM 92 161 9.8e-9 SMART
RRM 183 253 4.75e-7 SMART
low complexity region 339 368 N/A INTRINSIC
low complexity region 385 403 N/A INTRINSIC
RRM 409 478 5.09e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174526
Predicted Effect probably benign
Transcript: ENSMUST00000174548
SMART Domains Protein: ENSMUSP00000133728
Gene: ENSMUSG00000015165

DomainStartEndE-ValueType
low complexity region 3 57 N/A INTRINSIC
low complexity region 71 86 N/A INTRINSIC
RRM 100 169 9.8e-9 SMART
RRM 191 261 4.75e-7 SMART
low complexity region 314 339 N/A INTRINSIC
low complexity region 356 374 N/A INTRINSIC
RRM 380 449 5.09e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174755
Predicted Effect probably benign
Transcript: ENSMUST00000174882
AA Change: S184P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000133952
Gene: ENSMUSG00000015165
AA Change: S184P

DomainStartEndE-ValueType
RRM 1 61 5.18e-1 SMART
RRM 83 153 4.75e-7 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heterogeneous nuclear RNAs (hnRNAs) which include mRNA precursors and mature mRNAs are associated with specific proteins to form heterogenous ribonucleoprotein (hnRNP) complexes. Heterogeneous nuclear ribonucleoprotein L is among the proteins that are stably associated with hnRNP complexes and along with other hnRNP proteins is likely to play a major role in the formation, packaging, processing, and function of mRNA. Heterogeneous nuclear ribonucleoprotein L is present in the nucleoplasm as part of the HNRP complex. HNRP proteins have also been identified outside of the nucleoplasm. Exchange of hnRNP for mRNA-binding proteins accompanies transport of mRNA from the nucleus to the cytoplasm. Since HNRP proteins have been shown to shuttle between the nucleus and the cytoplasm, it is possible that they also have cytoplasmic functions. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic letahlity after E3.5. Mice homozygous for a conditional allele activated in thymocytes exhibit decreased T cells in the periphery associated with impaired thymocyte chemotaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,246,980 H618L probably benign Het
Adgrl3 A G 5: 81,766,234 T1230A probably benign Het
Ahnak2 A G 12: 112,785,739 S203P probably benign Het
Allc A G 12: 28,559,309 V244A probably benign Het
Ap3m1 G A 14: 21,037,157 P157L probably damaging Het
Arhgef2 T G 3: 88,632,943 I97S probably damaging Het
Btaf1 C A 19: 36,966,785 T398K probably benign Het
Cabp1 T C 5: 115,173,153 M158V probably damaging Het
Ccdc162 G A 10: 41,673,867 P340L probably benign Het
Clip4 A G 17: 71,834,222 K524E probably damaging Het
Cltc A G 11: 86,695,648 V189A probably benign Het
Cmc2 A G 8: 116,894,140 F34S probably damaging Het
Ctcfl G T 2: 173,113,656 T271N probably benign Het
Cyp4f16 T A 17: 32,542,764 F124I possibly damaging Het
Ddx41 C A 13: 55,531,648 R479L possibly damaging Het
Dgcr6 C A 16: 18,066,846 N87K possibly damaging Het
Dll1 A G 17: 15,368,859 L518P probably damaging Het
Dnaja4 G T 9: 54,710,644 M263I probably benign Het
Dusp13 T A 14: 21,743,525 probably benign Het
Fam185a T A 5: 21,480,377 I357N probably benign Het
Fam186a T C 15: 99,940,797 Y2522C unknown Het
Fam222a T A 5: 114,594,397 C4* probably null Het
Filip1 T C 9: 79,819,459 D626G probably damaging Het
Ghrhr C T 6: 55,388,187 R389C probably damaging Het
Gm8251 G A 1: 44,061,434 T168I possibly damaging Het
Gstm3 T A 3: 107,964,215 T217S probably benign Het
Gucy2g T C 19: 55,226,053 T548A probably benign Het
Hectd3 T A 4: 117,002,597 C744S probably null Het
Il3 G A 11: 54,267,257 probably benign Het
Itga5 C T 15: 103,354,084 G330S probably damaging Het
Kl A G 5: 150,980,847 T355A possibly damaging Het
Lipk A C 19: 34,032,320 S208R probably damaging Het
Mrs2 T A 13: 24,999,057 probably null Het
Mutyh A G 4: 116,817,690 E372G probably damaging Het
Myh4 C A 11: 67,258,992 A1821D probably benign Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nlrp12 T C 7: 3,231,061 E881G probably damaging Het
Nol9 T C 4: 152,052,095 probably benign Het
Nwd1 A G 8: 72,657,131 E52G probably damaging Het
Olfr1025-ps1 A G 2: 85,918,404 T160A probably benign Het
Olfr1294 T A 2: 111,537,974 H105L probably damaging Het
Olfr1415 A G 1: 92,490,975 V260A probably benign Het
Olfr1508 A T 14: 52,463,646 M121K probably damaging Het
Olfr449 T G 6: 42,837,849 probably null Het
Opn4 A G 14: 34,596,304 V242A probably damaging Het
Paxbp1 G A 16: 91,034,978 Q341* probably null Het
Pcdh7 T C 5: 57,720,411 V436A possibly damaging Het
Pcdhb18 G A 18: 37,489,814 V66M probably damaging Het
Pikfyve A G 1: 65,246,590 E951G possibly damaging Het
Plcg1 A G 2: 160,750,986 N179S probably benign Het
Prr11 A C 11: 87,098,691 S285A probably benign Het
Ranbp17 A G 11: 33,328,451 S139P probably damaging Het
Rasa4 G A 5: 136,091,810 probably null Het
Rnf213 G C 11: 119,442,763 G2934R probably benign Het
Rpap1 A G 2: 119,778,251 V210A probably benign Het
Rpn1 T A 6: 88,090,205 N182K probably benign Het
Rps24 C T 14: 24,491,787 T14I possibly damaging Het
Rrp12 C T 19: 41,877,505 probably null Het
Rttn T A 18: 89,090,415 probably null Het
Rufy1 A G 11: 50,401,493 S490P probably damaging Het
Sec62 T A 3: 30,809,869 M100K unknown Het
Spata16 A G 3: 26,732,932 H253R possibly damaging Het
Srcap T C 7: 127,558,962 probably benign Het
Srrm1 A G 4: 135,345,512 probably benign Het
Tbcd G A 11: 121,582,785 probably null Het
Tedc2 C A 17: 24,220,593 A25S probably damaging Het
Tnr A T 1: 159,684,788 probably benign Het
Tnxb A C 17: 34,718,007 D3730A probably damaging Het
Tor2a G A 2: 32,760,597 G201D probably damaging Het
Tpp1 T C 7: 105,746,649 T558A probably benign Het
Vmn1r211 G T 13: 22,852,126 Q124K probably benign Het
Wasf3 T C 5: 146,460,978 V185A probably benign Het
Zbtb12 A G 17: 34,896,009 T257A probably benign Het
Other mutations in Hnrnpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Hnrnpl APN 7 28813373 missense probably damaging 1.00
IGL00783:Hnrnpl APN 7 28820642 missense probably benign 0.02
IGL00784:Hnrnpl APN 7 28820642 missense probably benign 0.02
IGL03248:Hnrnpl APN 7 28814080 missense probably benign 0.00
R0143:Hnrnpl UTSW 7 28814192 splice site probably benign
R1529:Hnrnpl UTSW 7 28813923 missense possibly damaging 0.74
R1567:Hnrnpl UTSW 7 28820183 missense possibly damaging 0.73
R3786:Hnrnpl UTSW 7 28811011 unclassified probably benign
R5412:Hnrnpl UTSW 7 28811104 unclassified probably benign
R6617:Hnrnpl UTSW 7 28818584 intron probably benign
R7238:Hnrnpl UTSW 7 28813975 missense
R8283:Hnrnpl UTSW 7 28814272 missense
R8336:Hnrnpl UTSW 7 28814037 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ACACAGTGTGAGGAGCTGAC -3'
(R):5'- GTTAGGTAGGTAACAAGGCACCAAC -3'

Sequencing Primer
(F):5'- TGTGAGGAGCTGACCACAC -3'
(R):5'- CACTTGCAAATCAGTGGCTG -3'
Posted On2016-07-22