Incidental Mutation 'R4754:Haus4'
ID404221
Institutional Source Beutler Lab
Gene Symbol Haus4
Ensembl Gene ENSMUSG00000022177
Gene NameHAUS augmin-like complex, subunit 4
SynonymsD14Ertd500e, 9430093H08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R4754 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location54541785-54554616 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 54549892 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022784] [ENSMUST00000022784] [ENSMUST00000226358]
Predicted Effect probably null
Transcript: ENSMUST00000022784
SMART Domains Protein: ENSMUSP00000022784
Gene: ENSMUSG00000022177

DomainStartEndE-ValueType
Pfam:HAUS4 126 360 1.5e-87 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000022784
SMART Domains Protein: ENSMUSP00000022784
Gene: ENSMUSG00000022177

DomainStartEndE-ValueType
Pfam:HAUS4 126 360 1.5e-87 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000226358
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228043
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228883
Meta Mutation Damage Score 0.9594 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (107/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the centrosome complex termed the human augmin complex. The encoded protein localizes to the spindle microtubules and may play a role in mitotic spindle assembly and maintenance of centrosome integrity during cell division. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 1. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A T 9: 105,144,393 F151L probably benign Het
4932438A13Rik C T 3: 37,022,466 Q3663* probably null Het
A130010J15Rik A G 1: 193,174,529 Y63C probably damaging Het
Abcb4 C A 5: 8,910,717 F266L probably damaging Het
Adam8 A T 7: 139,984,780 I681N possibly damaging Het
Adgrf3 T A 5: 30,197,617 probably null Het
Ang2 A G 14: 51,195,517 V136A probably damaging Het
Ankar C T 1: 72,698,694 G110R probably damaging Het
Ap3b1 T C 13: 94,403,960 L130P probably damaging Het
Apc2 T G 10: 80,314,358 W1749G probably benign Het
Asb2 T C 12: 103,323,837 N565S possibly damaging Het
B3gnt7 C A 1: 86,305,557 T58K probably benign Het
Brpf1 T A 6: 113,320,447 N876K possibly damaging Het
Ccdc157 T C 11: 4,148,994 I69V possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh20 A T 1: 104,984,685 I555F probably damaging Het
Cfap73 T C 5: 120,629,664 D274G probably damaging Het
Chd5 T A 4: 152,377,746 I1310N probably damaging Het
Ckap2 T A 8: 22,168,895 I611F possibly damaging Het
Cpeb2 A G 5: 43,285,857 I964V possibly damaging Het
Ctbp2 C A 7: 133,023,558 probably null Het
Dhrs2 A T 14: 55,238,748 I142F probably damaging Het
Dnah5 T A 15: 28,420,955 probably null Het
Dst T C 1: 34,212,309 S1822P probably damaging Het
Ect2 T C 3: 27,126,963 K581E probably damaging Het
Edem1 C T 6: 108,841,697 T222M probably damaging Het
Eif2ak1 A G 5: 143,901,803 M592V probably damaging Het
Endou T G 15: 97,726,539 D49A probably damaging Het
Ensa A G 3: 95,622,554 probably benign Het
Evc2 G T 5: 37,387,031 R708L probably damaging Het
Fam120b T A 17: 15,422,962 C668S probably damaging Het
Fam135a A T 1: 24,028,754 C798* probably null Het
Fam135b T C 15: 71,462,951 D798G probably benign Het
Fam208a A T 14: 27,461,095 I504L probably benign Het
Fshb A C 2: 107,057,282 *131E probably null Het
G3bp2 C T 5: 92,054,909 V441M possibly damaging Het
Galnt6 A T 15: 100,699,224 F354I probably damaging Het
Gm1123 C A 9: 99,023,240 probably null Het
Gm1123 A T 9: 99,023,241 probably null Het
Gm15130 T C 2: 111,142,862 N115S unknown Het
Gm7104 A G 12: 88,285,995 noncoding transcript Het
Gm9762 A T 3: 78,966,421 noncoding transcript Het
Grip2 A G 6: 91,779,182 V508A probably damaging Het
Grip2 T C 6: 91,779,192 T505A probably damaging Het
Herc1 T A 9: 66,501,206 D4571E probably benign Het
Hnrnpk T A 13: 58,399,136 probably benign Het
Ica1l T C 1: 60,028,162 Y23C probably damaging Het
Kansl2-ps A G 7: 72,673,133 noncoding transcript Het
Kcnma1 T C 14: 23,363,836 D833G probably damaging Het
Kmt2e A T 5: 23,482,441 I430F possibly damaging Het
Lama2 C A 10: 27,118,531 R1794L possibly damaging Het
Mcpt1 T A 14: 56,018,680 F59I probably damaging Het
Mib2 G T 4: 155,655,365 T783K possibly damaging Het
Nlrp4g T C 9: 124,349,788 noncoding transcript Het
Obscn T C 11: 59,036,043 I6352V possibly damaging Het
Olfr1245 A T 2: 89,575,047 H226Q probably benign Het
Olfr1456-ps1 T A 19: 13,078,861 noncoding transcript Het
Olfr531 C T 7: 140,400,159 A296T probably damaging Het
Olfr68 T C 7: 103,777,668 I226V probably benign Het
Olfr728 T A 14: 50,140,033 N202I possibly damaging Het
Olfr728 T G 14: 50,140,034 N202H probably benign Het
Pcdh10 G A 3: 45,380,637 R462H probably damaging Het
Pcdhga12 C A 18: 37,766,551 N145K probably damaging Het
Pik3r6 T A 11: 68,544,775 L613Q probably damaging Het
Pknox2 T C 9: 36,909,720 D282G probably damaging Het
Plod2 T G 9: 92,606,531 Y624* probably null Het
Prkd3 C A 17: 78,956,614 V684F probably damaging Het
Ptpn1 T A 2: 167,974,160 V198D probably damaging Het
Ptpn12 G T 5: 20,998,589 P397Q probably benign Het
Rad1 C A 15: 10,493,126 probably benign Het
Rasl11a A G 5: 146,847,015 D90G probably benign Het
Rnf181 A G 6: 72,360,560 probably benign Het
Ryr3 T C 2: 112,757,639 I2652M possibly damaging Het
Siglecg C T 7: 43,411,871 probably benign Het
Slc22a3 T C 17: 12,507,195 S44G probably benign Het
Slc38a1 A T 15: 96,576,782 F463I probably damaging Het
Smg1 A T 7: 118,156,731 probably benign Het
Syk T C 13: 52,612,259 probably benign Het
Tbc1d5 T C 17: 50,800,165 I454M probably benign Het
Tmed6 C A 8: 107,063,730 D146Y probably damaging Het
Tmem132e A T 11: 82,444,851 K828* probably null Het
Tmprss15 A T 16: 79,054,124 S294T probably damaging Het
Trp53bp1 A G 2: 121,207,879 S1493P probably damaging Het
Tshb A T 3: 102,778,175 I46N probably damaging Het
Tspan11 T C 6: 127,938,220 V99A probably benign Het
Ttn T C 2: 76,715,561 T24176A probably benign Het
Vmn1r8 T C 6: 57,035,967 M1T probably null Het
Vmn2r104 A T 17: 20,040,768 Y464* probably null Het
Vmn2r110 T C 17: 20,596,196 T22A probably benign Het
Vmn2r17 T A 5: 109,452,849 I671K probably damaging Het
Zbtb21 T C 16: 97,951,266 N606D probably damaging Het
Zfy2 A T Y: 2,121,477 S139T probably benign Het
Zkscan17 G A 11: 59,503,025 R156* probably null Het
Zp2 A G 7: 120,138,318 V248A probably benign Het
Other mutations in Haus4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01903:Haus4 APN 14 54542429 missense possibly damaging 0.92
R1938:Haus4 UTSW 14 54544276 missense probably damaging 1.00
R4693:Haus4 UTSW 14 54549799 missense probably benign 0.34
R4714:Haus4 UTSW 14 54542120 missense probably benign 0.00
R4767:Haus4 UTSW 14 54548885 missense probably damaging 0.98
R4835:Haus4 UTSW 14 54545835 splice site probably null
R5230:Haus4 UTSW 14 54543794 missense probably benign 0.12
R5380:Haus4 UTSW 14 54549775 missense probably damaging 1.00
R5888:Haus4 UTSW 14 54544219 missense probably benign 0.00
R6594:Haus4 UTSW 14 54543811 missense possibly damaging 0.95
R7860:Haus4 UTSW 14 54542145 missense probably damaging 0.99
R7943:Haus4 UTSW 14 54542145 missense probably damaging 0.99
RF044:Haus4 UTSW 14 54544120 frame shift probably null
RF058:Haus4 UTSW 14 54550035 critical splice acceptor site probably benign
X0066:Haus4 UTSW 14 54549916 missense probably benign 0.25
Z1177:Haus4 UTSW 14 54549960 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACATAGTAGTCCACGAGCAGC -3'
(R):5'- ACTTGGGGTGAACGTCATC -3'

Sequencing Primer
(F):5'- ATAGTAGTCCACGAGCAGCTCTTG -3'
(R):5'- CTTCCAGGTCTGTGAGTTTGC -3'
Posted On2016-07-22