Incidental Mutation 'R5301:Sorcs2'
ID 404237
Institutional Source Beutler Lab
Gene Symbol Sorcs2
Ensembl Gene ENSMUSG00000029093
Gene Name sortilin-related VPS10 domain containing receptor 2
Synonyms VPS10 domain receptor protein
MMRRC Submission 042884-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5301 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 36174524-36555483 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 36196734 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 637 (V637A)
Ref Sequence ENSEMBL: ENSMUSP00000041828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037370]
AlphaFold Q9EPR5
Predicted Effect probably damaging
Transcript: ENSMUST00000037370
AA Change: V637A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041828
Gene: ENSMUSG00000029093
AA Change: V637A

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 106 130 N/A INTRINSIC
VPS10 170 780 N/A SMART
PKD 782 872 7.27e-2 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Meta Mutation Damage Score 0.2116 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 93% (52/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced dopamine levels and dopamine metabolism, dopaminergic hyperinnervation of the frontal cortex, hyperactivity, abnormal behavioral response to amphetamine, and decreased induction of Schwann cell apoptosis following sciatic nerve injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 121,896,502 (GRCm39) V578A probably damaging Het
Abcb11 T C 2: 69,117,191 (GRCm39) I486V probably damaging Het
Abcc9 G A 6: 142,536,207 (GRCm39) T1509I probably benign Het
Akr1c20 T A 13: 4,573,279 (GRCm39) D12V probably damaging Het
Asb1 A G 1: 91,482,475 (GRCm39) Y66C probably damaging Het
Atg14 G A 14: 47,805,656 (GRCm39) R70C probably damaging Het
Bcl10 A G 3: 145,636,342 (GRCm39) D80G probably damaging Het
Bdnf T C 2: 109,553,884 (GRCm39) V46A probably benign Het
Cyp11a1 A G 9: 57,926,544 (GRCm39) probably benign Het
Cyp3a44 A G 5: 145,725,326 (GRCm39) S292P probably damaging Het
Desi2 A G 1: 178,071,952 (GRCm39) I85M probably benign Het
Dnah2 C T 11: 69,349,746 (GRCm39) R2399Q probably benign Het
Dock10 T C 1: 80,625,973 (GRCm39) D49G probably benign Het
Epcam T A 17: 87,944,305 (GRCm39) L20Q possibly damaging Het
Ercc4 T C 16: 12,948,550 (GRCm39) V589A probably damaging Het
Fcgbp A T 7: 27,793,099 (GRCm39) K1034N possibly damaging Het
Fras1 C T 5: 96,805,125 (GRCm39) L1256F possibly damaging Het
Gata5 T C 2: 179,975,786 (GRCm39) Y126C probably damaging Het
Gja1 T C 10: 56,264,475 (GRCm39) L278P probably damaging Het
Gm11596 C A 11: 99,683,847 (GRCm39) R91L unknown Het
Gm29125 A T 1: 80,362,154 (GRCm39) noncoding transcript Het
Hcrtr1 G T 4: 130,031,463 (GRCm39) probably null Het
Ifi207 G A 1: 173,556,977 (GRCm39) S587L possibly damaging Het
Ino80d T C 1: 63,113,578 (GRCm39) T291A probably benign Het
Itgb3 A G 11: 104,524,480 (GRCm39) probably null Het
Kif26b A G 1: 178,358,233 (GRCm39) S115G unknown Het
Klc3 T C 7: 19,130,274 (GRCm39) Y301C probably damaging Het
Klhl18 G C 9: 110,265,195 (GRCm39) N335K possibly damaging Het
Meioc A T 11: 102,570,871 (GRCm39) R867S probably damaging Het
Mplkipl1 C T 19: 61,164,364 (GRCm39) G24R unknown Het
Mroh2a A G 1: 88,186,386 (GRCm39) S64G probably benign Het
Mthfd2 C A 6: 83,287,465 (GRCm39) G200V probably damaging Het
Nrap A G 19: 56,367,541 (GRCm39) I312T probably damaging Het
Nrp1 T G 8: 129,160,678 (GRCm39) probably null Het
Obscn A G 11: 59,026,234 (GRCm39) L323P probably damaging Het
Or11g1 T C 14: 50,651,030 (GRCm39) S10P probably benign Het
Or1b1 C T 2: 36,995,210 (GRCm39) V151M probably benign Het
Or9i14 G A 19: 13,792,933 (GRCm39) T7I probably damaging Het
Pkn2 A C 3: 142,544,967 (GRCm39) probably null Het
Ppp1r18 A G 17: 36,179,237 (GRCm39) R371G probably benign Het
Prkar2b A C 12: 32,025,927 (GRCm39) V31G probably damaging Het
Reg3b T A 6: 78,348,243 (GRCm39) M19K probably damaging Het
Sec14l2 G A 11: 4,068,727 (GRCm39) probably benign Het
Sgca C T 11: 94,854,157 (GRCm39) R104Q probably damaging Het
Slc17a6 A G 7: 51,308,519 (GRCm39) Y281C probably damaging Het
Tdrd9 T A 12: 112,002,963 (GRCm39) probably null Het
Tmem181a T C 17: 6,346,070 (GRCm39) I229T possibly damaging Het
Tmpo A T 10: 90,985,650 (GRCm39) probably benign Het
Ttc41 T C 10: 86,555,384 (GRCm39) V280A probably benign Het
Vmn1r234 G T 17: 21,449,589 (GRCm39) V168F probably benign Het
Vmn2r96 T A 17: 18,817,950 (GRCm39) I701N probably damaging Het
Wnt16 T A 6: 22,297,848 (GRCm39) M238K probably damaging Het
Zfp607b A G 7: 27,403,172 (GRCm39) T543A probably benign Het
Other mutations in Sorcs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Sorcs2 APN 5 36,194,745 (GRCm39) splice site probably null
IGL01064:Sorcs2 APN 5 36,222,696 (GRCm39) missense probably damaging 1.00
IGL01120:Sorcs2 APN 5 36,178,596 (GRCm39) missense probably damaging 0.99
IGL01730:Sorcs2 APN 5 36,205,153 (GRCm39) missense probably damaging 1.00
IGL02542:Sorcs2 APN 5 36,183,286 (GRCm39) missense probably damaging 0.98
IGL02730:Sorcs2 APN 5 36,219,896 (GRCm39) missense probably benign 0.11
IGL02965:Sorcs2 APN 5 36,235,301 (GRCm39) missense probably benign 0.13
IGL02997:Sorcs2 APN 5 36,225,492 (GRCm39) missense probably damaging 1.00
IGL03000:Sorcs2 APN 5 36,222,675 (GRCm39) unclassified probably benign
IGL03141:Sorcs2 APN 5 36,222,699 (GRCm39) missense probably benign 0.01
IGL03184:Sorcs2 APN 5 36,188,556 (GRCm39) missense probably benign 0.01
IGL03412:Sorcs2 APN 5 36,203,848 (GRCm39) missense probably damaging 1.00
R0180:Sorcs2 UTSW 5 36,311,189 (GRCm39) missense probably damaging 1.00
R0244:Sorcs2 UTSW 5 36,554,897 (GRCm39) splice site probably benign
R0345:Sorcs2 UTSW 5 36,185,218 (GRCm39) missense probably benign 0.01
R0519:Sorcs2 UTSW 5 36,188,534 (GRCm39) missense probably benign 0.08
R0624:Sorcs2 UTSW 5 36,222,777 (GRCm39) missense probably damaging 0.97
R0625:Sorcs2 UTSW 5 36,181,916 (GRCm39) missense possibly damaging 0.65
R1169:Sorcs2 UTSW 5 36,185,269 (GRCm39) missense possibly damaging 0.70
R1721:Sorcs2 UTSW 5 36,184,092 (GRCm39) missense probably damaging 0.98
R1809:Sorcs2 UTSW 5 36,386,564 (GRCm39) splice site probably benign
R1935:Sorcs2 UTSW 5 36,228,731 (GRCm39) missense possibly damaging 0.88
R1936:Sorcs2 UTSW 5 36,228,731 (GRCm39) missense possibly damaging 0.88
R2279:Sorcs2 UTSW 5 36,199,430 (GRCm39) splice site probably null
R3148:Sorcs2 UTSW 5 36,193,132 (GRCm39) missense probably benign 0.09
R3803:Sorcs2 UTSW 5 36,555,150 (GRCm39) missense probably benign 0.36
R3863:Sorcs2 UTSW 5 36,555,007 (GRCm39) nonsense probably null
R4092:Sorcs2 UTSW 5 36,183,166 (GRCm39) missense possibly damaging 0.92
R4620:Sorcs2 UTSW 5 36,194,838 (GRCm39) missense probably benign 0.00
R5079:Sorcs2 UTSW 5 36,200,796 (GRCm39) missense probably damaging 1.00
R5470:Sorcs2 UTSW 5 36,188,527 (GRCm39) missense probably benign 0.00
R5568:Sorcs2 UTSW 5 36,203,874 (GRCm39) nonsense probably null
R5727:Sorcs2 UTSW 5 36,188,630 (GRCm39) missense possibly damaging 0.52
R5874:Sorcs2 UTSW 5 36,386,555 (GRCm39) missense probably damaging 1.00
R5890:Sorcs2 UTSW 5 36,386,535 (GRCm39) missense probably damaging 1.00
R5946:Sorcs2 UTSW 5 36,186,427 (GRCm39) missense probably damaging 1.00
R6005:Sorcs2 UTSW 5 36,176,728 (GRCm39) missense probably damaging 1.00
R6048:Sorcs2 UTSW 5 36,185,332 (GRCm39) splice site probably null
R6290:Sorcs2 UTSW 5 36,219,931 (GRCm39) missense probably damaging 1.00
R6292:Sorcs2 UTSW 5 36,219,931 (GRCm39) missense probably damaging 1.00
R6617:Sorcs2 UTSW 5 36,235,310 (GRCm39) missense probably damaging 1.00
R6681:Sorcs2 UTSW 5 36,555,154 (GRCm39) missense probably benign 0.00
R7024:Sorcs2 UTSW 5 36,178,605 (GRCm39) missense probably damaging 0.99
R7056:Sorcs2 UTSW 5 36,225,474 (GRCm39) missense probably damaging 1.00
R7569:Sorcs2 UTSW 5 36,183,220 (GRCm39) missense probably benign 0.01
R7641:Sorcs2 UTSW 5 36,555,296 (GRCm39) missense probably damaging 0.99
R7651:Sorcs2 UTSW 5 36,185,322 (GRCm39) missense probably damaging 1.00
R7674:Sorcs2 UTSW 5 36,555,296 (GRCm39) missense probably damaging 0.99
R7722:Sorcs2 UTSW 5 36,200,871 (GRCm39) missense probably damaging 1.00
R7748:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R7764:Sorcs2 UTSW 5 36,181,416 (GRCm39) missense possibly damaging 0.48
R7813:Sorcs2 UTSW 5 36,181,958 (GRCm39) missense probably damaging 1.00
R8142:Sorcs2 UTSW 5 36,219,958 (GRCm39) missense possibly damaging 0.67
R8246:Sorcs2 UTSW 5 36,219,932 (GRCm39) missense probably damaging 1.00
R8254:Sorcs2 UTSW 5 36,195,550 (GRCm39) missense probably benign 0.00
R8349:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R8350:Sorcs2 UTSW 5 36,311,207 (GRCm39) missense probably damaging 0.96
R8354:Sorcs2 UTSW 5 36,222,753 (GRCm39) missense probably benign 0.01
R8449:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R8679:Sorcs2 UTSW 5 36,196,657 (GRCm39) missense probably benign 0.09
R8771:Sorcs2 UTSW 5 36,188,624 (GRCm39) missense probably damaging 1.00
R8935:Sorcs2 UTSW 5 36,193,202 (GRCm39) missense possibly damaging 0.79
R8964:Sorcs2 UTSW 5 36,386,511 (GRCm39) missense possibly damaging 0.85
R9164:Sorcs2 UTSW 5 36,235,312 (GRCm39) missense possibly damaging 0.94
R9221:Sorcs2 UTSW 5 36,181,910 (GRCm39) critical splice donor site probably null
R9290:Sorcs2 UTSW 5 36,183,225 (GRCm39) missense probably damaging 0.96
R9358:Sorcs2 UTSW 5 36,200,814 (GRCm39) missense probably damaging 1.00
R9492:Sorcs2 UTSW 5 36,186,484 (GRCm39) missense probably benign 0.08
R9493:Sorcs2 UTSW 5 36,199,529 (GRCm39) missense possibly damaging 0.61
R9640:Sorcs2 UTSW 5 36,222,765 (GRCm39) nonsense probably null
RF063:Sorcs2 UTSW 5 36,311,155 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTGCAGGTGCTAGGGTCATTAAG -3'
(R):5'- GCCAGTGGATGACATGTCAC -3'

Sequencing Primer
(F):5'- TGCTAGGGTCATTAAGAACTGC -3'
(R):5'- GATGACATGTCACATCCTCGAATC -3'
Posted On 2016-07-22