Incidental Mutation 'R5301:Meioc'
ID 404260
Institutional Source Beutler Lab
Gene Symbol Meioc
Ensembl Gene ENSMUSG00000051455
Gene Name meiosis specific with coiled-coil domain
Synonyms Gm1564, LOC380729, LOC268491
MMRRC Submission 042884-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock # R5301 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 102663716-102682237 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 102680045 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 867 (R867S)
Ref Sequence ENSEMBL: ENSMUSP00000097947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092569] [ENSMUST00000100378] [ENSMUST00000156590] [ENSMUST00000164506]
AlphaFold A2AG06
Predicted Effect probably benign
Transcript: ENSMUST00000092569
SMART Domains Protein: ENSMUSP00000090230
Gene: ENSMUSG00000020925

DomainStartEndE-ValueType
low complexity region 138 149 N/A INTRINSIC
coiled coil region 172 217 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100378
AA Change: R867S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097947
Gene: ENSMUSG00000051455
AA Change: R867S

DomainStartEndE-ValueType
low complexity region 526 537 N/A INTRINSIC
low complexity region 712 728 N/A INTRINSIC
Pfam:DUF4582 757 922 5.1e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156590
SMART Domains Protein: ENSMUSP00000116246
Gene: ENSMUSG00000051455

DomainStartEndE-ValueType
low complexity region 470 481 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164506
SMART Domains Protein: ENSMUSP00000127494
Gene: ENSMUSG00000020925

DomainStartEndE-ValueType
low complexity region 134 149 N/A INTRINSIC
coiled coil region 172 217 N/A INTRINSIC
Meta Mutation Damage Score 0.1629 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 93% (52/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit infertility with small gonads, absent germ cells and arrested meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,102,853 V578A probably damaging Het
Abcb11 T C 2: 69,286,847 I486V probably damaging Het
Abcc9 G A 6: 142,590,481 T1509I probably benign Het
Akr1c20 T A 13: 4,523,280 D12V probably damaging Het
Asb1 A G 1: 91,554,753 Y66C probably damaging Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Bcl10 A G 3: 145,930,587 D80G probably damaging Het
Bdnf T C 2: 109,723,539 V46A probably benign Het
Cyp11a1 A G 9: 58,019,261 probably benign Het
Cyp3a44 A G 5: 145,788,516 S292P probably damaging Het
Desi2 A G 1: 178,244,386 I85M probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock10 T C 1: 80,648,256 D49G probably benign Het
Epcam T A 17: 87,636,877 L20Q possibly damaging Het
Ercc4 T C 16: 13,130,686 V589A probably damaging Het
Fcgbp A T 7: 28,093,674 K1034N possibly damaging Het
Fras1 C T 5: 96,657,266 L1256F possibly damaging Het
Gata5 T C 2: 180,333,993 Y126C probably damaging Het
Gja1 T C 10: 56,388,379 L278P probably damaging Het
Gm11596 C A 11: 99,793,021 R91L unknown Het
Gm29125 A T 1: 80,384,437 noncoding transcript Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Hcrtr1 G T 4: 130,137,670 probably null Het
Ifi207 G A 1: 173,729,411 S587L possibly damaging Het
Ino80d T C 1: 63,074,419 T291A probably benign Het
Itgb3 A G 11: 104,633,654 probably null Het
Kif26b A G 1: 178,530,668 S115G unknown Het
Klc3 T C 7: 19,396,349 Y301C probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Mthfd2 C A 6: 83,310,483 G200V probably damaging Het
Nrap A G 19: 56,379,109 I312T probably damaging Het
Nrp1 T G 8: 128,434,197 probably null Het
Obscn A G 11: 59,135,408 L323P probably damaging Het
Olfr1499 G A 19: 13,815,569 T7I probably damaging Het
Olfr362 C T 2: 37,105,198 V151M probably benign Het
Olfr738 T C 14: 50,413,573 S10P probably benign Het
Pkn2 A C 3: 142,839,206 probably null Het
Ppp1r18 A G 17: 35,868,345 R371G probably benign Het
Prkar2b A C 12: 31,975,928 V31G probably damaging Het
Reg3b T A 6: 78,371,260 M19K probably damaging Het
Sec14l2 G A 11: 4,118,727 probably benign Het
Sgca C T 11: 94,963,331 R104Q probably damaging Het
Slc17a6 A G 7: 51,658,771 Y281C probably damaging Het
Sorcs2 A G 5: 36,039,390 V637A probably damaging Het
Tdrd9 T A 12: 112,036,529 probably null Het
Tmem181a T C 17: 6,295,795 I229T possibly damaging Het
Tmpo A T 10: 91,149,788 probably benign Het
Ttc41 T C 10: 86,719,520 V280A probably benign Het
Vmn1r234 G T 17: 21,229,327 V168F probably benign Het
Vmn2r96 T A 17: 18,597,688 I701N probably damaging Het
Wnt16 T A 6: 22,297,849 M238K probably damaging Het
Zfp607b A G 7: 27,703,747 T543A probably benign Het
Other mutations in Meioc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Meioc APN 11 102674287 missense probably benign 0.33
IGL01952:Meioc APN 11 102672185 missense possibly damaging 0.79
IGL02006:Meioc APN 11 102674266 missense probably damaging 1.00
IGL02195:Meioc APN 11 102674857 missense possibly damaging 0.91
IGL02339:Meioc APN 11 102668448 missense probably benign 0.18
IGL02935:Meioc APN 11 102672191 missense probably benign 0.06
IGL03294:Meioc APN 11 102680669 missense probably damaging 1.00
PIT4519001:Meioc UTSW 11 102679957 missense probably damaging 1.00
R0285:Meioc UTSW 11 102672191 missense probably benign 0.06
R0964:Meioc UTSW 11 102680031 missense probably damaging 1.00
R1074:Meioc UTSW 11 102675393 missense probably damaging 1.00
R2024:Meioc UTSW 11 102675358 missense probably benign 0.00
R4012:Meioc UTSW 11 102675828 missense probably damaging 0.99
R4429:Meioc UTSW 11 102675720 missense probably damaging 1.00
R4491:Meioc UTSW 11 102674920 missense possibly damaging 0.84
R4594:Meioc UTSW 11 102674166 missense probably damaging 1.00
R4752:Meioc UTSW 11 102674433 missense probably benign 0.00
R5352:Meioc UTSW 11 102675313 missense probably benign 0.03
R5646:Meioc UTSW 11 102675257 missense possibly damaging 0.94
R5958:Meioc UTSW 11 102675153 missense probably benign 0.41
R5968:Meioc UTSW 11 102675831 missense probably damaging 0.99
R6157:Meioc UTSW 11 102668401 missense probably damaging 1.00
R6410:Meioc UTSW 11 102675034 missense probably benign 0.00
R6644:Meioc UTSW 11 102668460 critical splice donor site probably null
R7285:Meioc UTSW 11 102666342 missense probably benign 0.00
R7440:Meioc UTSW 11 102674237 missense possibly damaging 0.67
R7815:Meioc UTSW 11 102675588 missense probably damaging 1.00
R7984:Meioc UTSW 11 102674606 missense possibly damaging 0.94
R8009:Meioc UTSW 11 102676743 missense probably damaging 1.00
R8078:Meioc UTSW 11 102668400 nonsense probably null
R8195:Meioc UTSW 11 102675067 nonsense probably null
R8429:Meioc UTSW 11 102674206 missense probably benign 0.06
R8797:Meioc UTSW 11 102676860 nonsense probably null
R8854:Meioc UTSW 11 102675763 missense probably damaging 0.98
R8891:Meioc UTSW 11 102668420 missense probably benign 0.43
R9081:Meioc UTSW 11 102674175 missense probably benign 0.00
R9360:Meioc UTSW 11 102674953 missense probably benign 0.13
Z1177:Meioc UTSW 11 102666364 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTCCACTACCATAGTCTTAGGACATAG -3'
(R):5'- TGCTGTTGCTACCAAATGATCAAAC -3'

Sequencing Primer
(F):5'- GGGCAAAATGGAACGTCT -3'
(R):5'- TGGTGATAGCTAAGATAATGAA -3'
Posted On 2016-07-22