Incidental Mutation 'R5301:Tdrd9'
ID404263
Institutional Source Beutler Lab
Gene Symbol Tdrd9
Ensembl Gene ENSMUSG00000054003
Gene Nametudor domain containing 9
Synonyms
MMRRC Submission 042884-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R5301 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location111971559-112068854 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 112036529 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000078022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079009]
Predicted Effect probably null
Transcript: ENSMUST00000079009
SMART Domains Protein: ENSMUSP00000078022
Gene: ENSMUSG00000054003

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
DEXDc 132 327 5.64e-21 SMART
HELICc 404 502 3.22e-16 SMART
low complexity region 547 561 N/A INTRINSIC
HA2 565 666 1.9e-20 SMART
TUDOR 944 1003 1.52e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191808
Predicted Effect probably benign
Transcript: ENSMUST00000192125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193586
Meta Mutation Damage Score 0.414 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 93% (52/56)
MGI Phenotype PHENOTYPE: Male homozygous mice are sterile, displaying small testis, arrest of male meiosis and abnormal spermatocyte morphology. Females are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,102,853 V578A probably damaging Het
Abcb11 T C 2: 69,286,847 I486V probably damaging Het
Abcc9 G A 6: 142,590,481 T1509I probably benign Het
Akr1c20 T A 13: 4,523,280 D12V probably damaging Het
Asb1 A G 1: 91,554,753 Y66C probably damaging Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Bcl10 A G 3: 145,930,587 D80G probably damaging Het
Bdnf T C 2: 109,723,539 V46A probably benign Het
Cyp11a1 A G 9: 58,019,261 probably benign Het
Cyp3a44 A G 5: 145,788,516 S292P probably damaging Het
Desi2 A G 1: 178,244,386 I85M probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock10 T C 1: 80,648,256 D49G probably benign Het
Epcam T A 17: 87,636,877 L20Q possibly damaging Het
Ercc4 T C 16: 13,130,686 V589A probably damaging Het
Fcgbp A T 7: 28,093,674 K1034N possibly damaging Het
Fras1 C T 5: 96,657,266 L1256F possibly damaging Het
Gata5 T C 2: 180,333,993 Y126C probably damaging Het
Gja1 T C 10: 56,388,379 L278P probably damaging Het
Gm11596 C A 11: 99,793,021 R91L unknown Het
Gm29125 A T 1: 80,384,437 noncoding transcript Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Hcrtr1 G T 4: 130,137,670 probably null Het
Ifi207 G A 1: 173,729,411 S587L possibly damaging Het
Ino80d T C 1: 63,074,419 T291A probably benign Het
Itgb3 A G 11: 104,633,654 probably null Het
Kif26b A G 1: 178,530,668 S115G unknown Het
Klc3 T C 7: 19,396,349 Y301C probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Meioc A T 11: 102,680,045 R867S probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Mthfd2 C A 6: 83,310,483 G200V probably damaging Het
Nrap A G 19: 56,379,109 I312T probably damaging Het
Nrp1 T G 8: 128,434,197 probably null Het
Obscn A G 11: 59,135,408 L323P probably damaging Het
Olfr1499 G A 19: 13,815,569 T7I probably damaging Het
Olfr362 C T 2: 37,105,198 V151M probably benign Het
Olfr738 T C 14: 50,413,573 S10P probably benign Het
Pkn2 A C 3: 142,839,206 probably null Het
Ppp1r18 A G 17: 35,868,345 R371G probably benign Het
Prkar2b A C 12: 31,975,928 V31G probably damaging Het
Reg3b T A 6: 78,371,260 M19K probably damaging Het
Sec14l2 G A 11: 4,118,727 probably benign Het
Sgca C T 11: 94,963,331 R104Q probably damaging Het
Slc17a6 A G 7: 51,658,771 Y281C probably damaging Het
Sorcs2 A G 5: 36,039,390 V637A probably damaging Het
Tmem181a T C 17: 6,295,795 I229T possibly damaging Het
Tmpo A T 10: 91,149,788 probably benign Het
Ttc41 T C 10: 86,719,520 V280A probably benign Het
Vmn1r234 G T 17: 21,229,327 V168F probably benign Het
Vmn2r96 T A 17: 18,597,688 I701N probably damaging Het
Wnt16 T A 6: 22,297,849 M238K probably damaging Het
Zfp607b A G 7: 27,703,747 T543A probably benign Het
Other mutations in Tdrd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Tdrd9 APN 12 112040434 missense probably damaging 1.00
IGL01373:Tdrd9 APN 12 112040434 missense probably damaging 1.00
IGL01542:Tdrd9 APN 12 112046989 missense possibly damaging 0.94
IGL02967:Tdrd9 APN 12 111992488 missense possibly damaging 0.50
IGL03063:Tdrd9 APN 12 112044299 missense probably benign 0.00
IGL03107:Tdrd9 APN 12 112042840 missense probably damaging 0.98
R0433:Tdrd9 UTSW 12 112025581 nonsense probably null
R0453:Tdrd9 UTSW 12 112068239 missense probably benign
R0655:Tdrd9 UTSW 12 112040465 missense probably damaging 1.00
R0666:Tdrd9 UTSW 12 112007580 intron probably benign
R1073:Tdrd9 UTSW 12 112023259 missense probably damaging 1.00
R1280:Tdrd9 UTSW 12 112039408 missense probably damaging 1.00
R1386:Tdrd9 UTSW 12 112044804 missense probably benign 0.21
R1521:Tdrd9 UTSW 12 112036410 missense probably damaging 1.00
R1601:Tdrd9 UTSW 12 112023253 nonsense probably null
R1651:Tdrd9 UTSW 12 112024706 missense probably damaging 0.97
R1715:Tdrd9 UTSW 12 112036439 missense possibly damaging 0.62
R1854:Tdrd9 UTSW 12 112044812 missense probably damaging 1.00
R1905:Tdrd9 UTSW 12 112063627 splice site probably benign
R2386:Tdrd9 UTSW 12 112015900 missense probably damaging 1.00
R2863:Tdrd9 UTSW 12 112031261 missense probably benign
R2915:Tdrd9 UTSW 12 112040461 missense probably damaging 1.00
R2958:Tdrd9 UTSW 12 112041672 missense probably damaging 0.97
R4033:Tdrd9 UTSW 12 111992539 missense possibly damaging 0.58
R4087:Tdrd9 UTSW 12 112013486 nonsense probably null
R4237:Tdrd9 UTSW 12 112067625 nonsense probably null
R4482:Tdrd9 UTSW 12 112014501 critical splice donor site probably null
R4501:Tdrd9 UTSW 12 112042809 missense probably benign 0.00
R4502:Tdrd9 UTSW 12 111993825 missense probably damaging 1.00
R4715:Tdrd9 UTSW 12 112041689 missense probably benign 0.00
R4803:Tdrd9 UTSW 12 111996835 nonsense probably null
R5218:Tdrd9 UTSW 12 112063475 intron probably benign
R5275:Tdrd9 UTSW 12 112051912 nonsense probably null
R5295:Tdrd9 UTSW 12 112051912 nonsense probably null
R5339:Tdrd9 UTSW 12 112027122 missense probably damaging 1.00
R5500:Tdrd9 UTSW 12 112023268 missense probably benign 0.02
R5573:Tdrd9 UTSW 12 111997902 synonymous probably null
R5590:Tdrd9 UTSW 12 112051980 missense probably benign 0.01
R5891:Tdrd9 UTSW 12 112042719 missense probably damaging 1.00
R6056:Tdrd9 UTSW 12 111985041 missense probably damaging 1.00
R6057:Tdrd9 UTSW 12 112013286 missense possibly damaging 0.85
R6125:Tdrd9 UTSW 12 112068198 missense possibly damaging 0.89
R6254:Tdrd9 UTSW 12 112025900 splice site probably null
R6335:Tdrd9 UTSW 12 112041752 critical splice donor site probably null
R6345:Tdrd9 UTSW 12 112034608 missense probably damaging 0.99
R6792:Tdrd9 UTSW 12 112027113 missense probably benign 0.01
R6956:Tdrd9 UTSW 12 112036354 splice site probably benign
R6987:Tdrd9 UTSW 12 112025593 missense possibly damaging 0.82
R7090:Tdrd9 UTSW 12 111992470 missense probably benign
R7158:Tdrd9 UTSW 12 112036366 missense probably benign 0.08
R7220:Tdrd9 UTSW 12 112014454 missense probably damaging 1.00
R7478:Tdrd9 UTSW 12 111985042 missense probably damaging 1.00
R7489:Tdrd9 UTSW 12 112067637 missense probably benign 0.00
X0018:Tdrd9 UTSW 12 112039329 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- TGTGGAGTTTTCACGGAATCC -3'
(R):5'- ACAGGGCCAATTTCTCCATC -3'

Sequencing Primer
(F):5'- TGGAGTTTTCACGGAATCCAACAG -3'
(R):5'- GTCCTTCAACAGCGGCATAG -3'
Posted On2016-07-22