Incidental Mutation 'R5301:Gm7102'
ID404275
Institutional Source Beutler Lab
Gene Symbol Gm7102
Ensembl Gene ENSMUSG00000094649
Gene Namepredicted gene 7102
Synonyms
MMRRC Submission 042884-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R5301 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location61174686-61176309 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61175926 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 24 (G24R)
Ref Sequence ENSEMBL: ENSMUSP00000137574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180168]
Predicted Effect unknown
Transcript: ENSMUST00000180168
AA Change: G24R
SMART Domains Protein: ENSMUSP00000137574
Gene: ENSMUSG00000094649
AA Change: G24R

DomainStartEndE-ValueType
Pfam:MPLKIP 31 170 8.9e-27 PFAM
Meta Mutation Damage Score 0.1094 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 93% (52/56)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,102,853 V578A probably damaging Het
Abcb11 T C 2: 69,286,847 I486V probably damaging Het
Abcc9 G A 6: 142,590,481 T1509I probably benign Het
Akr1c20 T A 13: 4,523,280 D12V probably damaging Het
Asb1 A G 1: 91,554,753 Y66C probably damaging Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Bcl10 A G 3: 145,930,587 D80G probably damaging Het
Bdnf T C 2: 109,723,539 V46A probably benign Het
Cyp11a1 A G 9: 58,019,261 probably benign Het
Cyp3a44 A G 5: 145,788,516 S292P probably damaging Het
Desi2 A G 1: 178,244,386 I85M probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock10 T C 1: 80,648,256 D49G probably benign Het
Epcam T A 17: 87,636,877 L20Q possibly damaging Het
Ercc4 T C 16: 13,130,686 V589A probably damaging Het
Fcgbp A T 7: 28,093,674 K1034N possibly damaging Het
Fras1 C T 5: 96,657,266 L1256F possibly damaging Het
Gata5 T C 2: 180,333,993 Y126C probably damaging Het
Gja1 T C 10: 56,388,379 L278P probably damaging Het
Gm11596 C A 11: 99,793,021 R91L unknown Het
Gm29125 A T 1: 80,384,437 noncoding transcript Het
Hcrtr1 G T 4: 130,137,670 probably null Het
Ifi207 G A 1: 173,729,411 S587L possibly damaging Het
Ino80d T C 1: 63,074,419 T291A probably benign Het
Itgb3 A G 11: 104,633,654 probably null Het
Kif26b A G 1: 178,530,668 S115G unknown Het
Klc3 T C 7: 19,396,349 Y301C probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Meioc A T 11: 102,680,045 R867S probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Mthfd2 C A 6: 83,310,483 G200V probably damaging Het
Nrap A G 19: 56,379,109 I312T probably damaging Het
Nrp1 T G 8: 128,434,197 probably null Het
Obscn A G 11: 59,135,408 L323P probably damaging Het
Olfr1499 G A 19: 13,815,569 T7I probably damaging Het
Olfr362 C T 2: 37,105,198 V151M probably benign Het
Olfr738 T C 14: 50,413,573 S10P probably benign Het
Pkn2 A C 3: 142,839,206 probably null Het
Ppp1r18 A G 17: 35,868,345 R371G probably benign Het
Prkar2b A C 12: 31,975,928 V31G probably damaging Het
Reg3b T A 6: 78,371,260 M19K probably damaging Het
Sec14l2 G A 11: 4,118,727 probably benign Het
Sgca C T 11: 94,963,331 R104Q probably damaging Het
Slc17a6 A G 7: 51,658,771 Y281C probably damaging Het
Sorcs2 A G 5: 36,039,390 V637A probably damaging Het
Tdrd9 T A 12: 112,036,529 probably null Het
Tmem181a T C 17: 6,295,795 I229T possibly damaging Het
Tmpo A T 10: 91,149,788 probably benign Het
Ttc41 T C 10: 86,719,520 V280A probably benign Het
Vmn1r234 G T 17: 21,229,327 V168F probably benign Het
Vmn2r96 T A 17: 18,597,688 I701N probably damaging Het
Wnt16 T A 6: 22,297,849 M238K probably damaging Het
Zfp607b A G 7: 27,703,747 T543A probably benign Het
Other mutations in Gm7102
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01718:Gm7102 APN 19 61175761 missense probably damaging 0.98
IGL02958:Gm7102 APN 19 61175680 missense possibly damaging 0.83
R0427:Gm7102 UTSW 19 61175470 missense probably damaging 1.00
R1886:Gm7102 UTSW 19 61175698 missense probably damaging 0.97
R4576:Gm7102 UTSW 19 61175926 missense unknown
R4578:Gm7102 UTSW 19 61175926 missense unknown
R4615:Gm7102 UTSW 19 61175926 missense unknown
R4616:Gm7102 UTSW 19 61175926 missense unknown
R4617:Gm7102 UTSW 19 61175926 missense unknown
R4621:Gm7102 UTSW 19 61175926 missense unknown
R4622:Gm7102 UTSW 19 61175926 missense unknown
R4623:Gm7102 UTSW 19 61175926 missense unknown
R4826:Gm7102 UTSW 19 61175926 missense unknown
R4827:Gm7102 UTSW 19 61175926 missense unknown
R4829:Gm7102 UTSW 19 61175926 missense unknown
R4830:Gm7102 UTSW 19 61175926 missense unknown
R4870:Gm7102 UTSW 19 61175926 missense unknown
R4871:Gm7102 UTSW 19 61175926 missense unknown
R4951:Gm7102 UTSW 19 61175926 missense unknown
R5112:Gm7102 UTSW 19 61175926 missense unknown
R5317:Gm7102 UTSW 19 61175926 missense unknown
R5335:Gm7102 UTSW 19 61175926 missense unknown
R5397:Gm7102 UTSW 19 61175926 missense unknown
R5399:Gm7102 UTSW 19 61175926 missense unknown
R5591:Gm7102 UTSW 19 61175926 missense unknown
R5592:Gm7102 UTSW 19 61175926 missense unknown
R5594:Gm7102 UTSW 19 61175926 missense unknown
R5616:Gm7102 UTSW 19 61175926 missense unknown
R5884:Gm7102 UTSW 19 61175926 missense unknown
R5919:Gm7102 UTSW 19 61175469 missense probably damaging 1.00
R7003:Gm7102 UTSW 19 61175881 missense possibly damaging 0.93
R7112:Gm7102 UTSW 19 61175559 missense probably damaging 1.00
R7266:Gm7102 UTSW 19 61175535 missense possibly damaging 0.84
Z1177:Gm7102 UTSW 19 61175750 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTAGCCGAACTGATGCTG -3'
(R):5'- CTTCTGGCAGTTGATCGCTGAG -3'

Sequencing Primer
(F):5'- AACTGATGCTGGGACCCC -3'
(R):5'- GATCGCTGAGGTTCGGC -3'
Posted On2016-07-22