Incidental Mutation 'R5302:Dlgap4'
ID404286
Institutional Source Beutler Lab
Gene Symbol Dlgap4
Ensembl Gene ENSMUSG00000061689
Gene NameDLG associated protein 4
SynonymsSAP90/PSD-95-associated protein 4, WBP16, PSD-95/SAP90 binding protein 4, Sapap4, DAP4
MMRRC Submission 042885-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R5302 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location156613705-156764363 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 156760898 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 147 (S147P)
Ref Sequence ENSEMBL: ENSMUSP00000129756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000094] [ENSMUST00000070782] [ENSMUST00000099145] [ENSMUST00000109566] [ENSMUST00000109567] [ENSMUST00000109568] [ENSMUST00000131157] [ENSMUST00000169464] [ENSMUST00000171030]
Predicted Effect probably damaging
Transcript: ENSMUST00000000094
AA Change: S160P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000094
Gene: ENSMUSG00000061689
AA Change: S160P

DomainStartEndE-ValueType
Pfam:GKAP 3 232 2.4e-81 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000070782
AA Change: S851P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000068745
Gene: ENSMUSG00000061689
AA Change: S851P

DomainStartEndE-ValueType
low complexity region 162 177 N/A INTRINSIC
low complexity region 253 277 N/A INTRINSIC
low complexity region 373 390 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
low complexity region 527 554 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
low complexity region 600 620 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
Pfam:GKAP 638 989 1.2e-132 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000099145
AA Change: S315P

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096749
Gene: ENSMUSG00000061689
AA Change: S315P

DomainStartEndE-ValueType
low complexity region 19 33 N/A INTRINSIC
low complexity region 61 81 N/A INTRINSIC
low complexity region 89 98 N/A INTRINSIC
Pfam:GKAP 114 453 2.4e-126 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109566
AA Change: S147P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105194
Gene: ENSMUSG00000061689
AA Change: S147P

DomainStartEndE-ValueType
Pfam:GKAP 1 285 2e-114 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109567
AA Change: S851P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105195
Gene: ENSMUSG00000061689
AA Change: S851P

DomainStartEndE-ValueType
low complexity region 162 177 N/A INTRINSIC
low complexity region 253 277 N/A INTRINSIC
low complexity region 373 390 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
low complexity region 527 554 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
low complexity region 600 620 N/A INTRINSIC
Pfam:GKAP 636 989 4.4e-116 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109568
AA Change: S837P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105196
Gene: ENSMUSG00000061689
AA Change: S837P

DomainStartEndE-ValueType
low complexity region 162 177 N/A INTRINSIC
low complexity region 253 277 N/A INTRINSIC
low complexity region 373 390 N/A INTRINSIC
low complexity region 463 480 N/A INTRINSIC
low complexity region 510 537 N/A INTRINSIC
low complexity region 541 555 N/A INTRINSIC
low complexity region 583 603 N/A INTRINSIC
low complexity region 611 620 N/A INTRINSIC
Pfam:GKAP 636 975 5.6e-126 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127944
Predicted Effect probably damaging
Transcript: ENSMUST00000131157
AA Change: S30P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134941
Gene: ENSMUSG00000061689
AA Change: S30P

DomainStartEndE-ValueType
Pfam:GKAP 1 110 2.2e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169464
AA Change: S854P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126980
Gene: ENSMUSG00000061689
AA Change: S854P

DomainStartEndE-ValueType
low complexity region 162 177 N/A INTRINSIC
low complexity region 253 277 N/A INTRINSIC
low complexity region 373 390 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
low complexity region 527 554 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
low complexity region 600 620 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
Pfam:GKAP 660 992 1.5e-148 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171030
AA Change: S147P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129756
Gene: ENSMUSG00000061689
AA Change: S147P

DomainStartEndE-ValueType
Pfam:GKAP 1 266 8.7e-103 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a membrane-associated guanylate kinase found at the postsynaptic density in neuronal cells. The encoded protein may play a role in synapse organization and neuronal signalling. Alternatively spliced transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Mar 2013]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,283,952 V1657A possibly damaging Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Acot5 A G 12: 84,073,441 Y190C probably damaging Het
Ascc3 T A 10: 50,707,777 Y941N probably benign Het
BC035947 A T 1: 78,511,962 M1K probably null Het
C2cd5 A G 6: 143,073,756 C278R probably benign Het
Cd200r1 G T 16: 44,792,809 L259F possibly damaging Het
Clcn4 A G 7: 7,294,051 V136A possibly damaging Het
Cntnap5a T C 1: 116,157,570 S413P probably benign Het
Corin T A 5: 72,316,098 E748D probably benign Het
Crtc2 G T 3: 90,261,018 G356V probably damaging Het
D1Pas1 T A 1: 186,969,445 Y524N probably damaging Het
Enpp1 A T 10: 24,651,390 I633N probably benign Het
Gm3095 A G 14: 3,964,498 D72G probably null Het
Gm5449 C T 13: 53,525,751 noncoding transcript Het
Gm6803 T A 12: 88,018,546 I76F probably damaging Het
Gpx7 T C 4: 108,400,914 T161A probably benign Het
Grip1 T C 10: 120,020,077 L236P probably damaging Het
H2-Q2 G T 17: 35,344,909 R255S probably damaging Het
Il17rc G T 6: 113,483,036 A648S possibly damaging Het
Klhl12 A G 1: 134,489,451 E540G possibly damaging Het
Mcm10 T C 2: 5,007,370 I135V probably benign Het
Mrps26 C A 2: 130,564,167 T100K probably benign Het
Nid2 A G 14: 19,779,701 T687A probably benign Het
Npas3 A T 12: 54,068,836 D829V probably damaging Het
Ocln T C 13: 100,506,299 D176G probably damaging Het
Olfr745 A G 14: 50,642,319 probably null Het
Pax3 A C 1: 78,121,612 M380R possibly damaging Het
Pcdha3 A G 18: 36,948,155 E650G probably damaging Het
Pdcd11 C A 19: 47,107,644 H668N probably damaging Het
Polr3b T C 10: 84,699,400 Y858H possibly damaging Het
Pus10 T C 11: 23,667,416 probably null Het
Raver1 T C 9: 21,075,381 D739G probably damaging Het
Slc26a11 T C 11: 119,363,450 L198P probably damaging Het
Slc44a3 A G 3: 121,510,313 V258A probably damaging Het
Socs7 T A 11: 97,389,199 I524N probably damaging Het
Steap4 T A 5: 7,975,547 L36* probably null Het
Svep1 G C 4: 58,096,183 T1479S possibly damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Ttn C A 2: 76,717,275 V32184F probably damaging Het
Vmn1r22 T C 6: 57,900,975 N6D possibly damaging Het
Other mutations in Dlgap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02164:Dlgap4 APN 2 156711139 missense probably damaging 1.00
IGL02732:Dlgap4 APN 2 156749323 missense probably benign 0.30
IGL02868:Dlgap4 APN 2 156700896 missense probably damaging 1.00
IGL03169:Dlgap4 APN 2 156711018 splice site probably null
IGL03220:Dlgap4 APN 2 156704626 missense probably damaging 1.00
E0374:Dlgap4 UTSW 2 156761843 missense probably damaging 1.00
R0413:Dlgap4 UTSW 2 156762826 missense probably damaging 1.00
R0573:Dlgap4 UTSW 2 156746191 missense probably benign 0.32
R0645:Dlgap4 UTSW 2 156761879 missense probably damaging 1.00
R0893:Dlgap4 UTSW 2 156745978 nonsense probably null
R1472:Dlgap4 UTSW 2 156760901 nonsense probably null
R1620:Dlgap4 UTSW 2 156749136 nonsense probably null
R1636:Dlgap4 UTSW 2 156746077 nonsense probably null
R2078:Dlgap4 UTSW 2 156762826 missense probably damaging 1.00
R2173:Dlgap4 UTSW 2 156762812 missense probably damaging 1.00
R2264:Dlgap4 UTSW 2 156701463 missense probably benign 0.00
R2348:Dlgap4 UTSW 2 156701206 missense possibly damaging 0.80
R3608:Dlgap4 UTSW 2 156748412 intron probably benign
R3872:Dlgap4 UTSW 2 156749347 missense probably benign 0.21
R3873:Dlgap4 UTSW 2 156749347 missense probably benign 0.21
R3874:Dlgap4 UTSW 2 156749347 missense probably benign 0.21
R3897:Dlgap4 UTSW 2 156746069 missense probably damaging 1.00
R5068:Dlgap4 UTSW 2 156707111 missense probably benign
R5286:Dlgap4 UTSW 2 156745919 missense probably damaging 1.00
R5568:Dlgap4 UTSW 2 156762901 makesense probably null
R5691:Dlgap4 UTSW 2 156704470 missense probably benign
R5741:Dlgap4 UTSW 2 156711048 missense probably damaging 1.00
R5917:Dlgap4 UTSW 2 156704540 missense probably damaging 1.00
R6140:Dlgap4 UTSW 2 156762729 unclassified probably null
R6992:Dlgap4 UTSW 2 156748940 splice site probably null
R7082:Dlgap4 UTSW 2 156748422 critical splice donor site probably null
R7566:Dlgap4 UTSW 2 156762737 missense probably benign 0.00
R7698:Dlgap4 UTSW 2 156749095 nonsense probably null
R7767:Dlgap4 UTSW 2 156746053 missense probably damaging 1.00
R7853:Dlgap4 UTSW 2 156705882 missense probably benign
R7944:Dlgap4 UTSW 2 156749134 missense probably damaging 0.96
R8366:Dlgap4 UTSW 2 156700774 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCACAGCCCACGTTTTAG -3'
(R):5'- GCAATGCCACCATCTTTACAG -3'

Sequencing Primer
(F):5'- GCCCACGTTTTAGTAACACAC -3'
(R):5'- ACCATCTTTACAGTGCCATGAGGG -3'
Posted On2016-07-22