Incidental Mutation 'R5302:Crtc2'
ID404287
Institutional Source Beutler Lab
Gene Symbol Crtc2
Ensembl Gene ENSMUSG00000027936
Gene NameCREB regulated transcription coactivator 2
Synonyms
MMRRC Submission 042885-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.414) question?
Stock #R5302 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location90254163-90264125 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 90261018 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 356 (G356V)
Ref Sequence ENSEMBL: ENSMUSP00000139194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029545] [ENSMUST00000129564] [ENSMUST00000184882]
Predicted Effect probably damaging
Transcript: ENSMUST00000029545
AA Change: G441V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029545
Gene: ENSMUSG00000027936
AA Change: G441V

DomainStartEndE-ValueType
Pfam:TORC_N 18 72 1.8e-20 PFAM
low complexity region 127 141 N/A INTRINSIC
Pfam:TORC_M 168 323 3.7e-71 PFAM
low complexity region 335 384 N/A INTRINSIC
low complexity region 391 416 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 484 494 N/A INTRINSIC
low complexity region 517 528 N/A INTRINSIC
Pfam:TORC_C 614 691 4.3e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123964
Predicted Effect probably benign
Transcript: ENSMUST00000129564
SMART Domains Protein: ENSMUSP00000117354
Gene: ENSMUSG00000042404

DomainStartEndE-ValueType
low complexity region 32 46 N/A INTRINSIC
uDENN 172 279 1.15e-29 SMART
DENN 313 497 5.26e-70 SMART
dDENN 562 636 1.75e-25 SMART
low complexity region 661 679 N/A INTRINSIC
low complexity region 729 741 N/A INTRINSIC
coiled coil region 891 917 N/A INTRINSIC
low complexity region 1011 1027 N/A INTRINSIC
low complexity region 1075 1085 N/A INTRINSIC
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1120 1137 N/A INTRINSIC
low complexity region 1327 1339 N/A INTRINSIC
low complexity region 1413 1428 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149897
Predicted Effect probably damaging
Transcript: ENSMUST00000184882
AA Change: G356V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139194
Gene: ENSMUSG00000027936
AA Change: G356V

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:TORC_M 83 239 6.5e-65 PFAM
low complexity region 250 299 N/A INTRINSIC
low complexity region 306 331 N/A INTRINSIC
low complexity region 347 354 N/A INTRINSIC
low complexity region 399 409 N/A INTRINSIC
low complexity region 432 443 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transducers of regulated cAMP response element-binding protein activity family of transcription coactivators. These proteins promote the transcription of genes targeted by the cAMP response element-binding protein, and therefore play an important role in many cellular processes. Under basal conditions the encoded protein is phosphorylated by AMP-activated protein kinase or the salt-inducible kinases and is sequestered in the cytoplasm. Upon activation by elevated cAMP or calcium, the encoded protein translocates to the nucleus and increases target gene expression. Single nucleotide polymorphisms in this gene may increase the risk of type 2 diabetes. A pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased circulating corticosterone levels, hepatocyte secretion of glucose in response to glucagon, and glycogen levels in liver and muscle cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,283,952 V1657A possibly damaging Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Acot5 A G 12: 84,073,441 Y190C probably damaging Het
Ascc3 T A 10: 50,707,777 Y941N probably benign Het
BC035947 A T 1: 78,511,962 M1K probably null Het
C2cd5 A G 6: 143,073,756 C278R probably benign Het
Cd200r1 G T 16: 44,792,809 L259F possibly damaging Het
Clcn4 A G 7: 7,294,051 V136A possibly damaging Het
Cntnap5a T C 1: 116,157,570 S413P probably benign Het
Corin T A 5: 72,316,098 E748D probably benign Het
D1Pas1 T A 1: 186,969,445 Y524N probably damaging Het
Dlgap4 T C 2: 156,760,898 S147P probably damaging Het
Enpp1 A T 10: 24,651,390 I633N probably benign Het
Gm3095 A G 14: 3,964,498 D72G probably null Het
Gm5449 C T 13: 53,525,751 noncoding transcript Het
Gm6803 T A 12: 88,018,546 I76F probably damaging Het
Gpx7 T C 4: 108,400,914 T161A probably benign Het
Grip1 T C 10: 120,020,077 L236P probably damaging Het
H2-Q2 G T 17: 35,344,909 R255S probably damaging Het
Il17rc G T 6: 113,483,036 A648S possibly damaging Het
Klhl12 A G 1: 134,489,451 E540G possibly damaging Het
Mcm10 T C 2: 5,007,370 I135V probably benign Het
Mrps26 C A 2: 130,564,167 T100K probably benign Het
Nid2 A G 14: 19,779,701 T687A probably benign Het
Npas3 A T 12: 54,068,836 D829V probably damaging Het
Ocln T C 13: 100,506,299 D176G probably damaging Het
Olfr745 A G 14: 50,642,319 probably null Het
Pax3 A C 1: 78,121,612 M380R possibly damaging Het
Pcdha3 A G 18: 36,948,155 E650G probably damaging Het
Pdcd11 C A 19: 47,107,644 H668N probably damaging Het
Polr3b T C 10: 84,699,400 Y858H possibly damaging Het
Pus10 T C 11: 23,667,416 probably null Het
Raver1 T C 9: 21,075,381 D739G probably damaging Het
Slc26a11 T C 11: 119,363,450 L198P probably damaging Het
Slc44a3 A G 3: 121,510,313 V258A probably damaging Het
Socs7 T A 11: 97,389,199 I524N probably damaging Het
Steap4 T A 5: 7,975,547 L36* probably null Het
Svep1 G C 4: 58,096,183 T1479S possibly damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Ttn C A 2: 76,717,275 V32184F probably damaging Het
Vmn1r22 T C 6: 57,900,975 N6D possibly damaging Het
Other mutations in Crtc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Crtc2 APN 3 90260805 missense probably damaging 0.98
IGL01874:Crtc2 APN 3 90258508 missense probably damaging 1.00
IGL02220:Crtc2 APN 3 90259148 splice site probably benign
IGL02454:Crtc2 APN 3 90259167 missense probably benign 0.00
IGL02957:Crtc2 APN 3 90262533 missense probably damaging 1.00
R0190:Crtc2 UTSW 3 90259409 missense probably damaging 1.00
R0492:Crtc2 UTSW 3 90263497 missense probably damaging 0.99
R0707:Crtc2 UTSW 3 90263497 missense probably damaging 0.99
R0751:Crtc2 UTSW 3 90262633 nonsense probably null
R1184:Crtc2 UTSW 3 90262633 nonsense probably null
R1521:Crtc2 UTSW 3 90257383 missense probably benign 0.10
R3856:Crtc2 UTSW 3 90262570 missense probably damaging 1.00
R4283:Crtc2 UTSW 3 90259236 splice site probably benign
R4747:Crtc2 UTSW 3 90260211 missense probably damaging 1.00
R5293:Crtc2 UTSW 3 90263564 missense probably benign
R5314:Crtc2 UTSW 3 90261041 nonsense probably null
R6170:Crtc2 UTSW 3 90259600 missense probably benign
R6887:Crtc2 UTSW 3 90261071 missense probably damaging 0.99
R7067:Crtc2 UTSW 3 90260182 missense probably benign 0.44
R7506:Crtc2 UTSW 3 90259212 missense probably damaging 1.00
R8169:Crtc2 UTSW 3 90263576 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTCACCCATCACTGCCTG -3'
(R):5'- ATGCCCGATGCCGAATACTC -3'

Sequencing Primer
(F):5'- TGGCCCACCATGCACTG -3'
(R):5'- CCGATGCCGAATACTCAGTGTATG -3'
Posted On2016-07-22