Mutagenetix > Incidental Mutations

Incidental Mutation 'R5302:Corin'

404293

Institutional Source

Beutler Lab

Gene Symbol

Corin

Ensembl Gene

ENSMUSG00000005220

Gene Name

corin

Synonyms

Lrp4

MMRRC Submission

042885-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.224) question?

Stock #

R5302 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

72300025-72504473 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 72316098 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 748 (E748D)

Ref Sequence

ENSEMBL: ENSMUSP00000135889 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005352] [ENSMUST00000167460] [ENSMUST00000175766] [ENSMUST00000176974] [ENSMUST00000177290]

Predicted Effect

probably benign
Transcript: ENSMUST00000005352
AA Change: E889D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000005352
Gene: ENSMUSG00000005220
AA Change: E889D

Domain	Start	End	E-Value	Type
low complexity region	3	15	N/A	INTRINSIC
transmembrane domain	113	135	N/A	INTRINSIC
FRI	205	318	6.15e-11	SMART
LDLa	336	372	1.31e-8	SMART
LDLa	373	408	1.5e-8	SMART
LDLa	409	447	5.47e-11	SMART
LDLa	448	484	1.22e-8	SMART
low complexity region	508	521	N/A	INTRINSIC
FRI	522	643	2.75e-31	SMART
LDLa	647	684	2.19e-10	SMART
LDLa	685	722	1.76e-5	SMART
LDLa	723	759	4.18e-7	SMART
SR	758	853	3.99e-10	SMART
Tryp_SPc	868	1097	5.45e-76	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000167460
AA Change: E823D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000127389
Gene: ENSMUSG00000005220
AA Change: E823D

Domain	Start	End	E-Value	Type
transmembrane domain	47	69	N/A	INTRINSIC
FRI	139	252	6.15e-11	SMART
LDLa	270	306	1.31e-8	SMART
LDLa	307	342	1.5e-8	SMART
LDLa	343	381	5.47e-11	SMART
LDLa	382	418	1.22e-8	SMART
low complexity region	442	455	N/A	INTRINSIC
FRI	456	577	2.75e-31	SMART
LDLa	581	618	2.19e-10	SMART
LDLa	619	656	1.76e-5	SMART
LDLa	657	693	4.18e-7	SMART
SR	692	787	3.99e-10	SMART
Tryp_SPc	802	1031	5.45e-76	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000175766
AA Change: E748D

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000135889
Gene: ENSMUSG00000005220
AA Change: E748D

Domain	Start	End	E-Value	Type
transmembrane domain	45	67	N/A	INTRINSIC
FRI	137	250	6.15e-11	SMART
LDLa	268	304	1.31e-8	SMART
LDLa	305	343	2.07e-11	SMART
low complexity region	367	380	N/A	INTRINSIC
FRI	381	502	2.75e-31	SMART
LDLa	506	543	2.19e-10	SMART
LDLa	544	581	1.76e-5	SMART
LDLa	582	618	4.18e-7	SMART
SR	617	712	3.99e-10	SMART
Tryp_SPc	727	956	5.45e-76	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176396

Predicted Effect

probably benign
Transcript: ENSMUST00000176974
AA Change: E786D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000135722
Gene: ENSMUSG00000005220
AA Change: E786D

Domain	Start	End	E-Value	Type
transmembrane domain	47	69	N/A	INTRINSIC
FRI	139	252	6.15e-11	SMART
LDLa	270	306	1.31e-8	SMART
LDLa	307	344	3.86e-11	SMART
LDLa	345	381	1.22e-8	SMART
low complexity region	405	418	N/A	INTRINSIC
FRI	419	540	2.75e-31	SMART
LDLa	544	581	2.19e-10	SMART
LDLa	582	619	1.76e-5	SMART
LDLa	620	656	4.18e-7	SMART
SR	655	750	3.99e-10	SMART
Tryp_SPc	765	994	5.45e-76	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000177290
AA Change: E756D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000135511
Gene: ENSMUSG00000005220
AA Change: E756D

Domain	Start	End	E-Value	Type
transmembrane domain	47	69	N/A	INTRINSIC
FRI	72	185	6.15e-11	SMART
LDLa	203	239	1.31e-8	SMART
LDLa	240	275	1.5e-8	SMART
LDLa	276	314	5.47e-11	SMART
LDLa	315	351	1.22e-8	SMART
low complexity region	375	388	N/A	INTRINSIC
FRI	389	510	2.75e-31	SMART
LDLa	514	551	2.19e-10	SMART
LDLa	552	589	1.76e-5	SMART
LDLa	590	626	4.18e-7	SMART
SR	625	720	3.99e-10	SMART
Tryp_SPc	735	964	5.45e-76	SMART

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II transmembrane serine protease class of the trypsin superfamily. Members of this family are composed of multiple structurally distinct domains. The encoded protein converts pro-atrial natriuretic peptide to biologically active atrial natriuretic peptide, a cardiac hormone that regulates blood volume and pressure. This protein may also function as a pro-brain-type natriuretic peptide convertase. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice display hypertension that is enhanced by high-salt diet and pregnancy, increased body weight, and cardiac hypertrophy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	A	G	1: 71,283,952	V1657A	possibly damaging	Het
Abca8b	C	A	11: 109,977,813	G175V	probably damaging	Het
Acot5	A	G	12: 84,073,441	Y190C	probably damaging	Het
Ascc3	T	A	10: 50,707,777	Y941N	probably benign	Het
BC035947	A	T	1: 78,511,962	M1K	probably null	Het
C2cd5	A	G	6: 143,073,756	C278R	probably benign	Het
Cd200r1	G	T	16: 44,792,809	L259F	possibly damaging	Het
Clcn4	A	G	7: 7,294,051	V136A	possibly damaging	Het
Cntnap5a	T	C	1: 116,157,570	S413P	probably benign	Het
Crtc2	G	T	3: 90,261,018	G356V	probably damaging	Het
D1Pas1	T	A	1: 186,969,445	Y524N	probably damaging	Het
Dlgap4	T	C	2: 156,760,898	S147P	probably damaging	Het
Enpp1	A	T	10: 24,651,390	I633N	probably benign	Het
Gm3095	A	G	14: 3,964,498	D72G	probably null	Het
Gm5449	C	T	13: 53,525,751		noncoding transcript	Het
Gm6803	T	A	12: 88,018,546	I76F	probably damaging	Het
Gpx7	T	C	4: 108,400,914	T161A	probably benign	Het
Grip1	T	C	10: 120,020,077	L236P	probably damaging	Het
H2-Q2	G	T	17: 35,344,909	R255S	probably damaging	Het
Il17rc	G	T	6: 113,483,036	A648S	possibly damaging	Het
Klhl12	A	G	1: 134,489,451	E540G	possibly damaging	Het
Mcm10	T	C	2: 5,007,370	I135V	probably benign	Het
Mrps26	C	A	2: 130,564,167	T100K	probably benign	Het
Nid2	A	G	14: 19,779,701	T687A	probably benign	Het
Npas3	A	T	12: 54,068,836	D829V	probably damaging	Het
Ocln	T	C	13: 100,506,299	D176G	probably damaging	Het
Olfr745	A	G	14: 50,642,319		probably null	Het
Pax3	A	C	1: 78,121,612	M380R	possibly damaging	Het
Pcdha3	A	G	18: 36,948,155	E650G	probably damaging	Het
Pdcd11	C	A	19: 47,107,644	H668N	probably damaging	Het
Polr3b	T	C	10: 84,699,400	Y858H	possibly damaging	Het
Pus10	T	C	11: 23,667,416		probably null	Het
Raver1	T	C	9: 21,075,381	D739G	probably damaging	Het
Slc26a11	T	C	11: 119,363,450	L198P	probably damaging	Het
Slc44a3	A	G	3: 121,510,313	V258A	probably damaging	Het
Socs7	T	A	11: 97,389,199	I524N	probably damaging	Het
Steap4	T	A	5: 7,975,547	L36*	probably null	Het
Svep1	G	C	4: 58,096,183	T1479S	possibly damaging	Het
Ttc37	G	A	13: 76,147,767	E1050K	possibly damaging	Het
Ttn	C	A	2: 76,717,275	V32184F	probably damaging	Het
Vmn1r22	T	C	6: 57,900,975	N6D	possibly damaging	Het

Other mutations in Corin

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00557:Corin	APN	5	72304888	missense	probably damaging	1.00
IGL01114:Corin	APN	5	72305011	missense	probably damaging	1.00
IGL01351:Corin	APN	5	72338991	missense	probably damaging	1.00
IGL01516:Corin	APN	5	72454487	nonsense	probably null
IGL01785:Corin	APN	5	72339876	missense	probably damaging	1.00
IGL01786:Corin	APN	5	72339876	missense	probably damaging	1.00
IGL01845:Corin	APN	5	72353939	missense	probably damaging	1.00
IGL02097:Corin	APN	5	72372146	missense	probably damaging	1.00
IGL02629:Corin	APN	5	72332673	missense	probably damaging	1.00
IGL03085:Corin	APN	5	72353930	missense	probably damaging	1.00
IGL03120:Corin	APN	5	72360689	missense	probably damaging	1.00
IGL03150:Corin	APN	5	72302858	missense	probably damaging	1.00
IGL03183:Corin	APN	5	72301586	missense	probably damaging	0.99
IGL03185:Corin	APN	5	72332781	missense	probably damaging	1.00
IGL03408:Corin	APN	5	72342961	missense	probably benign	0.40
alpaca	UTSW	5	72503952	missense	possibly damaging	0.85
R0078:Corin	UTSW	5	72454473	missense	possibly damaging	0.77
R0724:Corin	UTSW	5	72332795	splice site	probably benign
R1065:Corin	UTSW	5	72301650	nonsense	probably null
R1301:Corin	UTSW	5	72304933	missense	possibly damaging	0.81
R1466:Corin	UTSW	5	72302790	critical splice donor site	probably null
R1466:Corin	UTSW	5	72302790	critical splice donor site	probably null
R1520:Corin	UTSW	5	72330895	missense	probably damaging	1.00
R1584:Corin	UTSW	5	72302790	critical splice donor site	probably null
R1617:Corin	UTSW	5	72503952	missense	possibly damaging	0.85
R1912:Corin	UTSW	5	72358403	missense	probably damaging	1.00
R2059:Corin	UTSW	5	72316051	missense	possibly damaging	0.76
R2173:Corin	UTSW	5	72504079	missense	probably benign	0.01
R2242:Corin	UTSW	5	72332711	missense	probably damaging	1.00
R2373:Corin	UTSW	5	72339038	missense	probably damaging	1.00
R2850:Corin	UTSW	5	72304955	missense	probably damaging	1.00
R3683:Corin	UTSW	5	72330855	missense	probably damaging	1.00
R3684:Corin	UTSW	5	72330855	missense	probably damaging	1.00
R3790:Corin	UTSW	5	72435298	missense	probably benign	0.38
R3847:Corin	UTSW	5	72422165	missense	probably benign	0.13
R3926:Corin	UTSW	5	72372130	missense	probably damaging	1.00
R3939:Corin	UTSW	5	72339879	missense	possibly damaging	0.80
R3945:Corin	UTSW	5	72358424	missense	probably damaging	1.00
R4079:Corin	UTSW	5	72503883	missense	probably benign	0.03
R4224:Corin	UTSW	5	72343108	missense	probably damaging	1.00
R4473:Corin	UTSW	5	72339057	missense	probably damaging	1.00
R4585:Corin	UTSW	5	72329699	missense	probably damaging	1.00
R4586:Corin	UTSW	5	72329699	missense	probably damaging	1.00
R4849:Corin	UTSW	5	72302835	missense	probably damaging	1.00
R4926:Corin	UTSW	5	72372182	missense	probably damaging	1.00
R5080:Corin	UTSW	5	72353851	intron	probably benign
R5138:Corin	UTSW	5	72339059	missense	probably damaging	1.00
R5262:Corin	UTSW	5	72304955	missense	probably damaging	1.00
R5268:Corin	UTSW	5	72343019	missense	probably damaging	1.00
R5307:Corin	UTSW	5	72356978	missense	probably damaging	1.00
R5324:Corin	UTSW	5	72435257	missense	probably damaging	1.00
R5352:Corin	UTSW	5	72305033	missense	probably benign	0.04
R5373:Corin	UTSW	5	72304953	missense	probably damaging	1.00
R5374:Corin	UTSW	5	72304953	missense	probably damaging	1.00
R5484:Corin	UTSW	5	72358484	missense	probably benign	0.15
R5502:Corin	UTSW	5	72316106	nonsense	probably null
R5544:Corin	UTSW	5	72305014	nonsense	probably null
R5682:Corin	UTSW	5	72422154	missense	possibly damaging	0.85
R5818:Corin	UTSW	5	72435395	missense	probably benign	0.00
R5992:Corin	UTSW	5	72316389	missense	probably benign	0.01
R6115:Corin	UTSW	5	72360729	missense	probably damaging	1.00
R6181:Corin	UTSW	5	72372096	critical splice donor site	probably null
R6317:Corin	UTSW	5	72339045	missense	probably damaging	1.00
R7053:Corin	UTSW	5	72301527	missense	probably benign	0.28
R7242:Corin	UTSW	5	72305055	missense	probably benign	0.14
R7452:Corin	UTSW	5	72435247	missense	possibly damaging	0.94
R7783:Corin	UTSW	5	72301624	missense	probably benign	0.26
R7903:Corin	UTSW	5	72301500	missense	probably benign	0.00
R7956:Corin	UTSW	5	72422187	missense	probably damaging	0.99
R8007:Corin	UTSW	5	72316103	missense	probably damaging	0.96
R8125:Corin	UTSW	5	72358463	missense	probably damaging	0.96
R8215:Corin	UTSW	5	72305018	missense	probably damaging	1.00
R8251:Corin	UTSW	5	72356926	missense	probably damaging	1.00
R8364:Corin	UTSW	5	72304931	missense	probably benign
R8505:Corin	UTSW	5	72435407	missense	probably benign	0.21
R8746:Corin	UTSW	5	72435352	missense	probably benign	0.31
R8887:Corin	UTSW	5	72329610	critical splice donor site	probably null
Z1177:Corin	UTSW	5	72454493	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCTCCCGGGAGAAAGAATGG -3'
(R):5'- CTGGGAGACAGGATCCTTTG -3'

Sequencing Primer
(F):5'- CTCCCGGGAGAAAGAATGGCTATG -3'
(R):5'- AGACAGGATCCTTTGCGCATG -3'

Posted On

2016-07-22