Incidental Mutation 'R5302:Il17rc'
ID404297
Institutional Source Beutler Lab
Gene Symbol Il17rc
Ensembl Gene ENSMUSG00000030281
Gene Nameinterleukin 17 receptor C
Synonyms1110025H02Rik, IL17-RL, Il17rl
MMRRC Submission 042885-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5302 (G1)
Quality Score200
Status Not validated
Chromosome6
Chromosomal Location113471427-113483140 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 113483036 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 648 (A648S)
Ref Sequence ENSEMBL: ENSMUSP00000055343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032422] [ENSMUST00000058300]
Predicted Effect probably benign
Transcript: ENSMUST00000032422
SMART Domains Protein: ENSMUSP00000032422
Gene: ENSMUSG00000030284

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:DUF3456 45 103 1.7e-9 PFAM
EGF 154 193 2.11e1 SMART
FU 208 255 1.66e-1 SMART
EGF 213 244 2.2e1 SMART
EGF_like 245 290 4.26e-3 SMART
FU 268 315 4.46e-2 SMART
EGF_CA 305 344 1.1e-7 SMART
transmembrane domain 363 382 N/A INTRINSIC
transmembrane domain 387 406 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000058300
AA Change: A648S

PolyPhen 2 Score 0.709 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000055343
Gene: ENSMUSG00000030281
AA Change: A648S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:IL17_R_N 71 190 2.8e-45 PFAM
Pfam:IL17_R_N 189 432 1.3e-93 PFAM
transmembrane domain 441 460 N/A INTRINSIC
Pfam:SEFIR 473 623 7.7e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135852
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147932
Predicted Effect not run
Transcript: ENSMUST00000149899
AA Change: A552S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203668
Predicted Effect probably benign
Transcript: ENSMUST00000205208
AA Change: A552S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I membrane protein that shares similarity with the interleukin-17 receptor (IL-17RA). Unlike IL-17RA, which is predominantly expressed in hemopoietic cells, and binds with high affinity to only IL-17A, this protein is expressed in nonhemopoietic tissues, and binds both IL-17A and IL-17F with similar affinities. The proinflammatory cytokines, IL-17A and IL-17F, have been implicated in the progression of inflammatory and autoimmune diseases. Multiple alternatively spliced transcript variants encoding different isoforms have been detected for this gene, and it has been proposed that soluble, secreted proteins lacking transmembrane and intracellular domains may function as extracellular antagonists to cytokine signaling. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a reporter allele exhibit increased interleukin-17 secretion, reduced chemokine expression, and decreased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,283,952 V1657A possibly damaging Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Acot5 A G 12: 84,073,441 Y190C probably damaging Het
Ascc3 T A 10: 50,707,777 Y941N probably benign Het
BC035947 A T 1: 78,511,962 M1K probably null Het
C2cd5 A G 6: 143,073,756 C278R probably benign Het
Cd200r1 G T 16: 44,792,809 L259F possibly damaging Het
Clcn4 A G 7: 7,294,051 V136A possibly damaging Het
Cntnap5a T C 1: 116,157,570 S413P probably benign Het
Corin T A 5: 72,316,098 E748D probably benign Het
Crtc2 G T 3: 90,261,018 G356V probably damaging Het
D1Pas1 T A 1: 186,969,445 Y524N probably damaging Het
Dlgap4 T C 2: 156,760,898 S147P probably damaging Het
Enpp1 A T 10: 24,651,390 I633N probably benign Het
Gm3095 A G 14: 3,964,498 D72G probably null Het
Gm5449 C T 13: 53,525,751 noncoding transcript Het
Gm6803 T A 12: 88,018,546 I76F probably damaging Het
Gpx7 T C 4: 108,400,914 T161A probably benign Het
Grip1 T C 10: 120,020,077 L236P probably damaging Het
H2-Q2 G T 17: 35,344,909 R255S probably damaging Het
Klhl12 A G 1: 134,489,451 E540G possibly damaging Het
Mcm10 T C 2: 5,007,370 I135V probably benign Het
Mrps26 C A 2: 130,564,167 T100K probably benign Het
Nid2 A G 14: 19,779,701 T687A probably benign Het
Npas3 A T 12: 54,068,836 D829V probably damaging Het
Ocln T C 13: 100,506,299 D176G probably damaging Het
Olfr745 A G 14: 50,642,319 probably null Het
Pax3 A C 1: 78,121,612 M380R possibly damaging Het
Pcdha3 A G 18: 36,948,155 E650G probably damaging Het
Pdcd11 C A 19: 47,107,644 H668N probably damaging Het
Polr3b T C 10: 84,699,400 Y858H possibly damaging Het
Pus10 T C 11: 23,667,416 probably null Het
Raver1 T C 9: 21,075,381 D739G probably damaging Het
Slc26a11 T C 11: 119,363,450 L198P probably damaging Het
Slc44a3 A G 3: 121,510,313 V258A probably damaging Het
Socs7 T A 11: 97,389,199 I524N probably damaging Het
Steap4 T A 5: 7,975,547 L36* probably null Het
Svep1 G C 4: 58,096,183 T1479S possibly damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Ttn C A 2: 76,717,275 V32184F probably damaging Het
Vmn1r22 T C 6: 57,900,975 N6D possibly damaging Het
Other mutations in Il17rc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Il17rc APN 6 113474171 missense probably damaging 0.96
IGL03192:Il17rc APN 6 113472885 missense probably damaging 1.00
R1462:Il17rc UTSW 6 113478989 missense probably damaging 1.00
R1462:Il17rc UTSW 6 113478989 missense probably damaging 1.00
R4075:Il17rc UTSW 6 113481197 missense possibly damaging 0.82
R5025:Il17rc UTSW 6 113472366 missense possibly damaging 0.62
R5052:Il17rc UTSW 6 113472323 missense probably damaging 1.00
R5148:Il17rc UTSW 6 113482997 missense probably benign 0.19
R5977:Il17rc UTSW 6 113482731 missense probably damaging 0.98
R6275:Il17rc UTSW 6 113480347 missense probably benign 0.00
R7010:Il17rc UTSW 6 113479288 missense possibly damaging 0.86
R8031:Il17rc UTSW 6 113482821 missense probably damaging 1.00
R8138:Il17rc UTSW 6 113482539 missense probably damaging 1.00
R8160:Il17rc UTSW 6 113476528 missense possibly damaging 0.94
R8209:Il17rc UTSW 6 113472810 missense probably benign 0.01
Z1176:Il17rc UTSW 6 113476795 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TACCCGATTTCCTGCAAGG -3'
(R):5'- ACCTGTCCGGGCTTTAAAG -3'

Sequencing Primer
(F):5'- TACGTCGGGGTCTACTTCGAC -3'
(R):5'- TCCGGGCTTTAAAGGGCAG -3'
Posted On2016-07-22