Incidental Mutation 'R5302:Enpp1'
List |< first << previous [record 14 of 42] next >> last >|
ID404303
Institutional Source Beutler Lab
Gene Symbol Enpp1
Ensembl Gene ENSMUSG00000037370
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 1
SynonymsPC-1, Npps, E-NPP1, Pca-1, twy, NPP1, 4833416E15Rik, Pdnp1, Pca, CD203c, Ly-41
MMRRC Submission 042885-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.289) question?
Stock #R5302 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location24637914-24712159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24651390 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 633 (I633N)
Ref Sequence ENSEMBL: ENSMUSP00000114273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039882] [ENSMUST00000105520] [ENSMUST00000135846]
Predicted Effect probably benign
Transcript: ENSMUST00000039882
SMART Domains Protein: ENSMUSP00000046090
Gene: ENSMUSG00000037370

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
low complexity region 59 69 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 358 1e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105520
AA Change: I632N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101159
Gene: ENSMUSG00000037370
AA Change: I632N

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 1.8e-87 PFAM
Endonuclease_NS 655 873 5.33e-15 SMART
NUC 656 887 3.62e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135846
AA Change: I633N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114273
Gene: ENSMUSG00000037370
AA Change: I633N

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 4.2e-91 PFAM
Endonuclease_NS 656 874 5.33e-15 SMART
NUC 657 888 3.62e-107 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150570
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the nucleoside pyrophosphatase/phosphodiesterase family of enzymes that catalyzes the hydrolysis of pyrophosphate and phosphodiester bonds in nucleotide triphosphates and oligonucleotides, respectively, to generate nucleoside 5'-monophosphates. The encoded protein is a type II transmembrane glycoprotein that negatively regulates bone mineralization. Mice harboring a nonsense mutation in this gene, termed tiptoe walking (ttw), exhibit ectopic ossification of the spinal ligaments. The encoded protein binds to the insulin receptor, inhibits downstream signaling events and induces insulin resistance and glucose tolerance. This gene is located adjacent to a paralog on chromosome 10. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele develop hyperostosis leading to ossific intervertebral fusion, peripheral joint ankylosis and tendon calcification, and display spontaneous arterial and articular cartilage calcification, and altered adipocyte maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,283,952 V1657A possibly damaging Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Acot5 A G 12: 84,073,441 Y190C probably damaging Het
Ascc3 T A 10: 50,707,777 Y941N probably benign Het
BC035947 A T 1: 78,511,962 M1K probably null Het
C2cd5 A G 6: 143,073,756 C278R probably benign Het
Cd200r1 G T 16: 44,792,809 L259F possibly damaging Het
Clcn4 A G 7: 7,294,051 V136A possibly damaging Het
Cntnap5a T C 1: 116,157,570 S413P probably benign Het
Corin T A 5: 72,316,098 E748D probably benign Het
Crtc2 G T 3: 90,261,018 G356V probably damaging Het
D1Pas1 T A 1: 186,969,445 Y524N probably damaging Het
Dlgap4 T C 2: 156,760,898 S147P probably damaging Het
Gm3095 A G 14: 3,964,498 D72G probably null Het
Gm5449 C T 13: 53,525,751 noncoding transcript Het
Gm6803 T A 12: 88,018,546 I76F probably damaging Het
Gpx7 T C 4: 108,400,914 T161A probably benign Het
Grip1 T C 10: 120,020,077 L236P probably damaging Het
H2-Q2 G T 17: 35,344,909 R255S probably damaging Het
Il17rc G T 6: 113,483,036 A648S possibly damaging Het
Klhl12 A G 1: 134,489,451 E540G possibly damaging Het
Mcm10 T C 2: 5,007,370 I135V probably benign Het
Mrps26 C A 2: 130,564,167 T100K probably benign Het
Nid2 A G 14: 19,779,701 T687A probably benign Het
Npas3 A T 12: 54,068,836 D829V probably damaging Het
Ocln T C 13: 100,506,299 D176G probably damaging Het
Olfr745 A G 14: 50,642,319 probably null Het
Pax3 A C 1: 78,121,612 M380R possibly damaging Het
Pcdha3 A G 18: 36,948,155 E650G probably damaging Het
Pdcd11 C A 19: 47,107,644 H668N probably damaging Het
Polr3b T C 10: 84,699,400 Y858H possibly damaging Het
Pus10 T C 11: 23,667,416 probably null Het
Raver1 T C 9: 21,075,381 D739G probably damaging Het
Slc26a11 T C 11: 119,363,450 L198P probably damaging Het
Slc44a3 A G 3: 121,510,313 V258A probably damaging Het
Socs7 T A 11: 97,389,199 I524N probably damaging Het
Steap4 T A 5: 7,975,547 L36* probably null Het
Svep1 G C 4: 58,096,183 T1479S possibly damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Ttn C A 2: 76,717,275 V32184F probably damaging Het
Vmn1r22 T C 6: 57,900,975 N6D possibly damaging Het
Other mutations in Enpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Enpp1 APN 10 24645427 missense possibly damaging 0.93
IGL00966:Enpp1 APN 10 24654031 missense probably damaging 1.00
IGL01364:Enpp1 APN 10 24664614 missense probably damaging 1.00
IGL02040:Enpp1 APN 10 24655856 missense probably damaging 1.00
IGL02143:Enpp1 APN 10 24677974 missense probably damaging 1.00
IGL02631:Enpp1 APN 10 24641961 missense probably damaging 1.00
IGL02655:Enpp1 APN 10 24677974 missense probably damaging 1.00
IGL02677:Enpp1 APN 10 24679185 splice site probably benign
IGL02691:Enpp1 APN 10 24711892 missense probably damaging 0.99
IGL02966:Enpp1 APN 10 24660274 missense probably damaging 1.00
IGL03087:Enpp1 APN 10 24655881 splice site probably benign
IGL03330:Enpp1 APN 10 24664906 splice site probably benign
IGL03365:Enpp1 APN 10 24669025 missense probably damaging 1.00
IGL03377:Enpp1 APN 10 24660283 critical splice acceptor site probably null
PIT4651001:Enpp1 UTSW 10 24653950 missense probably benign 0.16
R0011:Enpp1 UTSW 10 24670002 nonsense probably null
R0201:Enpp1 UTSW 10 24653917 missense probably benign 0.00
R0496:Enpp1 UTSW 10 24672052 missense probably benign 0.18
R1228:Enpp1 UTSW 10 24645412 missense probably benign 0.30
R1536:Enpp1 UTSW 10 24641834 missense probably benign 0.27
R1927:Enpp1 UTSW 10 24654888 missense possibly damaging 0.65
R2051:Enpp1 UTSW 10 24711804 critical splice donor site probably null
R2057:Enpp1 UTSW 10 24660192 missense probably damaging 0.98
R2353:Enpp1 UTSW 10 24651341 missense probably benign 0.24
R4077:Enpp1 UTSW 10 24669007 critical splice donor site probably null
R4079:Enpp1 UTSW 10 24669007 critical splice donor site probably null
R4739:Enpp1 UTSW 10 24679248 missense probably null 0.99
R4740:Enpp1 UTSW 10 24679248 missense probably null 0.99
R4761:Enpp1 UTSW 10 24641951 missense possibly damaging 0.94
R4822:Enpp1 UTSW 10 24661935 missense possibly damaging 0.74
R4919:Enpp1 UTSW 10 24648085 missense probably benign 0.01
R5140:Enpp1 UTSW 10 24652852 missense possibly damaging 0.51
R5421:Enpp1 UTSW 10 24669757 missense probably damaging 1.00
R5695:Enpp1 UTSW 10 24654908 missense probably damaging 0.99
R5735:Enpp1 UTSW 10 24654919 missense possibly damaging 0.92
R5789:Enpp1 UTSW 10 24647239 missense probably benign
R5942:Enpp1 UTSW 10 24676068 nonsense probably null
R6048:Enpp1 UTSW 10 24660254 missense probably damaging 1.00
R6053:Enpp1 UTSW 10 24657126 missense possibly damaging 0.93
R6305:Enpp1 UTSW 10 24641882 missense probably damaging 1.00
R6319:Enpp1 UTSW 10 24648031 missense probably damaging 1.00
R6624:Enpp1 UTSW 10 24669755 nonsense probably null
R6793:Enpp1 UTSW 10 24655825 missense probably damaging 1.00
R6936:Enpp1 UTSW 10 24651339 missense probably benign 0.30
R7255:Enpp1 UTSW 10 24645315 missense possibly damaging 0.95
R7285:Enpp1 UTSW 10 24660161 missense probably benign 0.01
R7401:Enpp1 UTSW 10 24645282 missense probably damaging 1.00
R7429:Enpp1 UTSW 10 24711950 missense probably benign 0.00
R7430:Enpp1 UTSW 10 24711950 missense probably benign 0.00
R7526:Enpp1 UTSW 10 24674410 splice site probably null
R7532:Enpp1 UTSW 10 24675987 missense probably benign 0.29
R7789:Enpp1 UTSW 10 24654083 splice site probably null
R8073:Enpp1 UTSW 10 24679244 missense possibly damaging 0.50
R8283:Enpp1 UTSW 10 24674656 missense probably benign 0.25
Z1177:Enpp1 UTSW 10 24661942 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TAAACTGCTTTCAACATAGCGC -3'
(R):5'- AAGGTAGTATTCTCCTGTGACACTTC -3'

Sequencing Primer
(F):5'- TGCTTTCAACATAGCGCAAAGAAG -3'
(R):5'- CCTGAGACGTTTGTGACA -3'
Posted On2016-07-22