Incidental Mutation 'R5302:Pus10'
List |< first << previous [record 33 of 42] next >> last >|
ID404306
Institutional Source Beutler Lab
Gene Symbol Pus10
Ensembl Gene ENSMUSG00000020280
Gene Namepseudouridylate synthase 10
SynonymsCcdc139, 4933435A13Rik, 2810013G11Rik
MMRRC Submission 042885-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5302 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location23665674-23732876 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 23667416 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020520] [ENSMUST00000020523] [ENSMUST00000058163] [ENSMUST00000109525] [ENSMUST00000130811] [ENSMUST00000143117] [ENSMUST00000143117]
Predicted Effect probably null
Transcript: ENSMUST00000020520
SMART Domains Protein: ENSMUSP00000020520
Gene: ENSMUSG00000020280

DomainStartEndE-ValueType
PDB:2V9K|A 1 527 N/A PDB
Predicted Effect probably benign
Transcript: ENSMUST00000020523
SMART Domains Protein: ENSMUSP00000020523
Gene: ENSMUSG00000020283

DomainStartEndE-ValueType
low complexity region 5 11 N/A INTRINSIC
low complexity region 18 30 N/A INTRINSIC
Pfam:Peroxin-13_N 101 256 3.6e-51 PFAM
SH3 277 337 1.42e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000058163
SMART Domains Protein: ENSMUSP00000050395
Gene: ENSMUSG00000020280

DomainStartEndE-ValueType
PDB:2V9K|A 1 527 N/A PDB
Predicted Effect probably null
Transcript: ENSMUST00000109525
SMART Domains Protein: ENSMUSP00000105151
Gene: ENSMUSG00000020280

DomainStartEndE-ValueType
PDB:2V9K|A 1 527 N/A PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124839
Predicted Effect probably benign
Transcript: ENSMUST00000130811
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136365
Predicted Effect probably null
Transcript: ENSMUST00000143117
SMART Domains Protein: ENSMUSP00000117934
Gene: ENSMUSG00000020280

DomainStartEndE-ValueType
PDB:2V9K|A 1 140 4e-65 PDB
Predicted Effect probably null
Transcript: ENSMUST00000143117
SMART Domains Protein: ENSMUSP00000117934
Gene: ENSMUSG00000020280

DomainStartEndE-ValueType
PDB:2V9K|A 1 140 4e-65 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146533
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pseudouridination, the isomerization of uridine to pseudouridine, is the most common posttranscriptional nucleotide modification found in RNA and is essential for biologic functions such as spliceosome biogenesis. Pseudouridylate synthases, such as PUS10, catalyze pseudouridination of structural RNAs, including transfer, ribosomal, and splicing RNAs. These enzymes also act as RNA chaperones, facilitating the correct folding and assembly of tRNAs (McCleverty et al., 2007 [PubMed 17900615]).[supplied by OMIM, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,283,952 V1657A possibly damaging Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Acot5 A G 12: 84,073,441 Y190C probably damaging Het
Ascc3 T A 10: 50,707,777 Y941N probably benign Het
BC035947 A T 1: 78,511,962 M1K probably null Het
C2cd5 A G 6: 143,073,756 C278R probably benign Het
Cd200r1 G T 16: 44,792,809 L259F possibly damaging Het
Clcn4 A G 7: 7,294,051 V136A possibly damaging Het
Cntnap5a T C 1: 116,157,570 S413P probably benign Het
Corin T A 5: 72,316,098 E748D probably benign Het
Crtc2 G T 3: 90,261,018 G356V probably damaging Het
D1Pas1 T A 1: 186,969,445 Y524N probably damaging Het
Dlgap4 T C 2: 156,760,898 S147P probably damaging Het
Enpp1 A T 10: 24,651,390 I633N probably benign Het
Gm3095 A G 14: 3,964,498 D72G probably null Het
Gm5449 C T 13: 53,525,751 noncoding transcript Het
Gm6803 T A 12: 88,018,546 I76F probably damaging Het
Gpx7 T C 4: 108,400,914 T161A probably benign Het
Grip1 T C 10: 120,020,077 L236P probably damaging Het
H2-Q2 G T 17: 35,344,909 R255S probably damaging Het
Il17rc G T 6: 113,483,036 A648S possibly damaging Het
Klhl12 A G 1: 134,489,451 E540G possibly damaging Het
Mcm10 T C 2: 5,007,370 I135V probably benign Het
Mrps26 C A 2: 130,564,167 T100K probably benign Het
Nid2 A G 14: 19,779,701 T687A probably benign Het
Npas3 A T 12: 54,068,836 D829V probably damaging Het
Ocln T C 13: 100,506,299 D176G probably damaging Het
Olfr745 A G 14: 50,642,319 probably null Het
Pax3 A C 1: 78,121,612 M380R possibly damaging Het
Pcdha3 A G 18: 36,948,155 E650G probably damaging Het
Pdcd11 C A 19: 47,107,644 H668N probably damaging Het
Polr3b T C 10: 84,699,400 Y858H possibly damaging Het
Raver1 T C 9: 21,075,381 D739G probably damaging Het
Slc26a11 T C 11: 119,363,450 L198P probably damaging Het
Slc44a3 A G 3: 121,510,313 V258A probably damaging Het
Socs7 T A 11: 97,389,199 I524N probably damaging Het
Steap4 T A 5: 7,975,547 L36* probably null Het
Svep1 G C 4: 58,096,183 T1479S possibly damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Ttn C A 2: 76,717,275 V32184F probably damaging Het
Vmn1r22 T C 6: 57,900,975 N6D possibly damaging Het
Other mutations in Pus10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02260:Pus10 APN 11 23707548 nonsense probably null
IGL02304:Pus10 APN 11 23712275 missense probably damaging 1.00
IGL02466:Pus10 APN 11 23725574 missense probably damaging 0.99
IGL02967:Pus10 APN 11 23718602 missense probably damaging 1.00
IGL03233:Pus10 APN 11 23712241 missense probably damaging 1.00
IGL03300:Pus10 APN 11 23731368 utr 3 prime probably benign
PIT4486001:Pus10 UTSW 11 23712326 critical splice donor site probably null
PIT4677001:Pus10 UTSW 11 23720171 missense possibly damaging 0.88
R0166:Pus10 UTSW 11 23667358 missense probably damaging 1.00
R0440:Pus10 UTSW 11 23673331 unclassified probably benign
R0519:Pus10 UTSW 11 23711201 missense probably benign 0.02
R1583:Pus10 UTSW 11 23673239 missense probably damaging 0.96
R1714:Pus10 UTSW 11 23725542 missense probably damaging 1.00
R1941:Pus10 UTSW 11 23711198 missense possibly damaging 0.60
R3687:Pus10 UTSW 11 23667334 missense probably benign
R3688:Pus10 UTSW 11 23667334 missense probably benign
R3854:Pus10 UTSW 11 23703003 critical splice donor site probably null
R4064:Pus10 UTSW 11 23728983 missense probably damaging 1.00
R4127:Pus10 UTSW 11 23718654 critical splice donor site probably null
R4276:Pus10 UTSW 11 23706895 missense probably damaging 1.00
R4655:Pus10 UTSW 11 23672707 missense probably benign 0.02
R5580:Pus10 UTSW 11 23672556 missense probably benign 0.16
R6196:Pus10 UTSW 11 23672638 missense probably benign 0.15
R6549:Pus10 UTSW 11 23729075 critical splice donor site probably null
R6722:Pus10 UTSW 11 23702975 missense possibly damaging 0.93
R6724:Pus10 UTSW 11 23729037 missense possibly damaging 0.78
X0064:Pus10 UTSW 11 23708743 splice site probably null
Predicted Primers PCR Primer
(F):5'- GTAGCTGTAGAATACTGAAAGTGC -3'
(R):5'- CTCTCTGCACTAACTGTTAAATGATAG -3'

Sequencing Primer
(F):5'- CTGAAAGTGCTCATTTTAGTTTCTTC -3'
(R):5'- GGCCATCTTTTGATACATAGGCAGC -3'
Posted On2016-07-22