Incidental Mutation 'R5302:Slc26a11'
ID404309
Institutional Source Beutler Lab
Gene Symbol Slc26a11
Ensembl Gene ENSMUSG00000039908
Gene Namesolute carrier family 26, member 11
Synonyms
MMRRC Submission 042885-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5302 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location119355557-119381079 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119363450 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 198 (L198P)
Ref Sequence ENSEMBL: ENSMUSP00000050999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050880]
Predicted Effect probably damaging
Transcript: ENSMUST00000050880
AA Change: L198P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000050999
Gene: ENSMUSG00000039908
AA Change: L198P

DomainStartEndE-ValueType
Pfam:Sulfate_transp 31 424 1.8e-97 PFAM
transmembrane domain 426 448 N/A INTRINSIC
Pfam:STAS 453 559 3.6e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147366
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151612
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute linked carrier 26 family of anion exchangers. Members of this family of proteins are essential for numerous cellular functions including homeostasis and intracellular electrolyte balance. The encoded protein is a sodium independent sulfate transporter that is sensitive to the anion exchanger inhibitor 4,4'-diisothiocyanostilbene-2,2'-disulfonic acid. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,283,952 V1657A possibly damaging Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Acot5 A G 12: 84,073,441 Y190C probably damaging Het
Ascc3 T A 10: 50,707,777 Y941N probably benign Het
BC035947 A T 1: 78,511,962 M1K probably null Het
C2cd5 A G 6: 143,073,756 C278R probably benign Het
Cd200r1 G T 16: 44,792,809 L259F possibly damaging Het
Clcn4 A G 7: 7,294,051 V136A possibly damaging Het
Cntnap5a T C 1: 116,157,570 S413P probably benign Het
Corin T A 5: 72,316,098 E748D probably benign Het
Crtc2 G T 3: 90,261,018 G356V probably damaging Het
D1Pas1 T A 1: 186,969,445 Y524N probably damaging Het
Dlgap4 T C 2: 156,760,898 S147P probably damaging Het
Enpp1 A T 10: 24,651,390 I633N probably benign Het
Gm3095 A G 14: 3,964,498 D72G probably null Het
Gm5449 C T 13: 53,525,751 noncoding transcript Het
Gm6803 T A 12: 88,018,546 I76F probably damaging Het
Gpx7 T C 4: 108,400,914 T161A probably benign Het
Grip1 T C 10: 120,020,077 L236P probably damaging Het
H2-Q2 G T 17: 35,344,909 R255S probably damaging Het
Il17rc G T 6: 113,483,036 A648S possibly damaging Het
Klhl12 A G 1: 134,489,451 E540G possibly damaging Het
Mcm10 T C 2: 5,007,370 I135V probably benign Het
Mrps26 C A 2: 130,564,167 T100K probably benign Het
Nid2 A G 14: 19,779,701 T687A probably benign Het
Npas3 A T 12: 54,068,836 D829V probably damaging Het
Ocln T C 13: 100,506,299 D176G probably damaging Het
Olfr745 A G 14: 50,642,319 probably null Het
Pax3 A C 1: 78,121,612 M380R possibly damaging Het
Pcdha3 A G 18: 36,948,155 E650G probably damaging Het
Pdcd11 C A 19: 47,107,644 H668N probably damaging Het
Polr3b T C 10: 84,699,400 Y858H possibly damaging Het
Pus10 T C 11: 23,667,416 probably null Het
Raver1 T C 9: 21,075,381 D739G probably damaging Het
Slc44a3 A G 3: 121,510,313 V258A probably damaging Het
Socs7 T A 11: 97,389,199 I524N probably damaging Het
Steap4 T A 5: 7,975,547 L36* probably null Het
Svep1 G C 4: 58,096,183 T1479S possibly damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Ttn C A 2: 76,717,275 V32184F probably damaging Het
Vmn1r22 T C 6: 57,900,975 N6D possibly damaging Het
Other mutations in Slc26a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Slc26a11 APN 11 119379901 missense probably benign 0.00
IGL01359:Slc26a11 APN 11 119363431 missense probably benign 0.00
IGL01835:Slc26a11 APN 11 119377214 missense probably benign
R0193:Slc26a11 UTSW 11 119359314 missense probably damaging 1.00
R0362:Slc26a11 UTSW 11 119379941 splice site probably benign
R0709:Slc26a11 UTSW 11 119374777 missense probably damaging 1.00
R1800:Slc26a11 UTSW 11 119373153 missense probably damaging 0.97
R1964:Slc26a11 UTSW 11 119380194 missense possibly damaging 0.93
R4762:Slc26a11 UTSW 11 119356831 unclassified probably benign
R5153:Slc26a11 UTSW 11 119377259 missense possibly damaging 0.67
R5660:Slc26a11 UTSW 11 119357978 missense probably damaging 0.98
R5994:Slc26a11 UTSW 11 119379912 missense probably benign 0.14
R6025:Slc26a11 UTSW 11 119374828 missense probably damaging 1.00
R6275:Slc26a11 UTSW 11 119359299 missense probably benign 0.44
R6970:Slc26a11 UTSW 11 119356972 missense probably damaging 1.00
R6974:Slc26a11 UTSW 11 119358018 missense possibly damaging 0.82
R7466:Slc26a11 UTSW 11 119374502 missense probably damaging 0.99
R8210:Slc26a11 UTSW 11 119379866 missense possibly damaging 0.84
X0026:Slc26a11 UTSW 11 119380230 missense probably benign
X0028:Slc26a11 UTSW 11 119380194 missense possibly damaging 0.93
Z1177:Slc26a11 UTSW 11 119356959 missense not run
Predicted Primers PCR Primer
(F):5'- GCCATAAACTGAGCCCATGC -3'
(R):5'- CTGTGTCTTCAGCTCAGCATAG -3'

Sequencing Primer
(F):5'- ATGCTGACTGCCCGCCTC -3'
(R):5'- AGCATAGCTGGGAAGCCC -3'
Posted On2016-07-22