Mutagenetix > Incidental Mutation

Incidental Mutation 'R5302:Npas3'

404310

Institutional Source

Beutler Lab

Gene Symbol

Npas3

Ensembl Gene

ENSMUSG00000021010

Gene Name

neuronal PAS domain protein 3

Synonyms

4930423H22Rik, bHLHe12

MMRRC Submission

042885-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.928) question?

Stock #

R5302 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

53248677-54072175 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 54068836 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 829 (D829V)

Ref Sequence

ENSEMBL: ENSMUSP00000152452 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000101432] [ENSMUST00000223057] [ENSMUST00000223358]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000101432
AA Change: D847V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000098975
Gene: ENSMUSG00000021010
AA Change: D847V

Domain	Start	End	E-Value	Type
HLH	64	119	1.34e-6	SMART
PAS	154	220	8.69e-11	SMART
low complexity region	234	256	N/A	INTRINSIC
PAS	326	392	7.4e-5	SMART
PAC	398	441	2.46e-1	SMART
low complexity region	461	477	N/A	INTRINSIC
low complexity region	524	544	N/A	INTRINSIC
low complexity region	598	627	N/A	INTRINSIC
low complexity region	696	709	N/A	INTRINSIC
low complexity region	739	754	N/A	INTRINSIC
low complexity region	759	773	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185390

Predicted Effect

probably damaging
Transcript: ENSMUST00000223057
AA Change: D829V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000223358
AA Change: D816V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic helix-loop-helix and PAS domain-containing family of transcription factors. The encoded protein is localized to the nucleus and may regulate genes involved in neurogenesis. Chromosomal abnormalities that affect the coding potential of this gene are associated with schizophrenia and mental retardation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for some knock-out alleles exhibit abnormal behavior and nervous system morphology. Mice homozygous for another knock-out allele exhibit defective lung branching morphogenesis and die shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	A	G	1: 71,283,952	V1657A	possibly damaging	Het
Abca8b	C	A	11: 109,977,813	G175V	probably damaging	Het
Acot5	A	G	12: 84,073,441	Y190C	probably damaging	Het
Ascc3	T	A	10: 50,707,777	Y941N	probably benign	Het
BC035947	A	T	1: 78,511,962	M1K	probably null	Het
C2cd5	A	G	6: 143,073,756	C278R	probably benign	Het
Cd200r1	G	T	16: 44,792,809	L259F	possibly damaging	Het
Clcn4	A	G	7: 7,294,051	V136A	possibly damaging	Het
Cntnap5a	T	C	1: 116,157,570	S413P	probably benign	Het
Corin	T	A	5: 72,316,098	E748D	probably benign	Het
Crtc2	G	T	3: 90,261,018	G356V	probably damaging	Het
D1Pas1	T	A	1: 186,969,445	Y524N	probably damaging	Het
Dlgap4	T	C	2: 156,760,898	S147P	probably damaging	Het
Enpp1	A	T	10: 24,651,390	I633N	probably benign	Het
Gm3095	A	G	14: 3,964,498	D72G	probably null	Het
Gm5449	C	T	13: 53,525,751		noncoding transcript	Het
Gm6803	T	A	12: 88,018,546	I76F	probably damaging	Het
Gpx7	T	C	4: 108,400,914	T161A	probably benign	Het
Grip1	T	C	10: 120,020,077	L236P	probably damaging	Het
H2-Q2	G	T	17: 35,344,909	R255S	probably damaging	Het
Il17rc	G	T	6: 113,483,036	A648S	possibly damaging	Het
Klhl12	A	G	1: 134,489,451	E540G	possibly damaging	Het
Mcm10	T	C	2: 5,007,370	I135V	probably benign	Het
Mrps26	C	A	2: 130,564,167	T100K	probably benign	Het
Nid2	A	G	14: 19,779,701	T687A	probably benign	Het
Ocln	T	C	13: 100,506,299	D176G	probably damaging	Het
Olfr745	A	G	14: 50,642,319		probably null	Het
Pax3	A	C	1: 78,121,612	M380R	possibly damaging	Het
Pcdha3	A	G	18: 36,948,155	E650G	probably damaging	Het
Pdcd11	C	A	19: 47,107,644	H668N	probably damaging	Het
Polr3b	T	C	10: 84,699,400	Y858H	possibly damaging	Het
Pus10	T	C	11: 23,667,416		probably null	Het
Raver1	T	C	9: 21,075,381	D739G	probably damaging	Het
Slc26a11	T	C	11: 119,363,450	L198P	probably damaging	Het
Slc44a3	A	G	3: 121,510,313	V258A	probably damaging	Het
Socs7	T	A	11: 97,389,199	I524N	probably damaging	Het
Steap4	T	A	5: 7,975,547	L36*	probably null	Het
Svep1	G	C	4: 58,096,183	T1479S	possibly damaging	Het
Ttc37	G	A	13: 76,147,767	E1050K	possibly damaging	Het
Ttn	C	A	2: 76,717,275	V32184F	probably damaging	Het
Vmn1r22	T	C	6: 57,900,975	N6D	possibly damaging	Het

Other mutations in Npas3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01021:Npas3	APN	12	54003560	missense	probably damaging	1.00
IGL01330:Npas3	APN	12	54048819	missense	probably damaging	1.00
IGL01376:Npas3	APN	12	54044586	missense	probably benign	0.01
IGL01634:Npas3	APN	12	53947163	missense	probably damaging	1.00
IGL02456:Npas3	APN	12	54048767	missense	probably damaging	0.99
IGL02663:Npas3	APN	12	54068908	missense	probably damaging	1.00
IGL02731:Npas3	APN	12	54067795	missense	probably benign	0.01
IGL02955:Npas3	APN	12	53501265	missense	probably damaging	0.96
IGL03001:Npas3	APN	12	53501192	missense	probably damaging	1.00
IGL03047:Npas3	APN	12	53831687	splice site	probably benign
ANU05:Npas3	UTSW	12	54068074	missense	possibly damaging	0.49
IGL02837:Npas3	UTSW	12	53947197	missense	possibly damaging	0.79
R0042:Npas3	UTSW	12	54048841	missense	probably damaging	1.00
R0042:Npas3	UTSW	12	54048841	missense	probably damaging	1.00
R0396:Npas3	UTSW	12	53831745	missense	probably damaging	1.00
R1687:Npas3	UTSW	12	54048875	splice site	probably null
R1863:Npas3	UTSW	12	54068826	missense	probably damaging	1.00
R2004:Npas3	UTSW	12	54067897	missense	possibly damaging	0.63
R2047:Npas3	UTSW	12	54068829	missense	probably damaging	0.99
R2049:Npas3	UTSW	12	54062088	missense	probably damaging	1.00
R2278:Npas3	UTSW	12	53640502	missense	possibly damaging	0.92
R2323:Npas3	UTSW	12	54068346	missense	probably damaging	1.00
R2871:Npas3	UTSW	12	54068013	nonsense	probably null
R2871:Npas3	UTSW	12	54068013	nonsense	probably null
R3116:Npas3	UTSW	12	54067725	splice site	probably null
R3431:Npas3	UTSW	12	54069049	missense	probably damaging	0.99
R3731:Npas3	UTSW	12	53354392	missense	probably benign	0.11
R3767:Npas3	UTSW	12	54069074	makesense	probably null
R4332:Npas3	UTSW	12	54062069	missense	probably damaging	0.99
R4593:Npas3	UTSW	12	54068497	missense	probably benign	0.08
R4601:Npas3	UTSW	12	54044578	missense	probably damaging	0.99
R4654:Npas3	UTSW	12	54062132	critical splice donor site	probably null
R4946:Npas3	UTSW	12	54065835	missense	probably damaging	1.00
R5140:Npas3	UTSW	12	53501114	nonsense	probably null
R5524:Npas3	UTSW	12	54068938	missense	possibly damaging	0.64
R5735:Npas3	UTSW	12	54003479	missense	probably benign	0.00
R6252:Npas3	UTSW	12	54068890	missense	probably damaging	1.00
R6438:Npas3	UTSW	12	54068698	missense	probably damaging	0.99
R6987:Npas3	UTSW	12	54068253	missense	possibly damaging	0.94
R6994:Npas3	UTSW	12	54068793	missense	probably damaging	0.96
R7304:Npas3	UTSW	12	54069041	missense	probably damaging	1.00
R7684:Npas3	UTSW	12	54068826	missense	probably damaging	1.00
R7724:Npas3	UTSW	12	54068341	missense	possibly damaging	0.90
R7739:Npas3	UTSW	12	54068718	missense	probably damaging	1.00
R7826:Npas3	UTSW	12	53831756	missense	possibly damaging	0.92
R8017:Npas3	UTSW	12	54044679	missense	probably damaging	1.00
R8019:Npas3	UTSW	12	54044679	missense	probably damaging	1.00
R8034:Npas3	UTSW	12	53640529	missense	probably damaging	1.00
R8422:Npas3	UTSW	12	54068509	missense	probably benign
R9172:Npas3	UTSW	12	54065870	missense	probably benign	0.08
R9207:Npas3	UTSW	12	54068035	missense	possibly damaging	0.87
R9774:Npas3	UTSW	12	53947325	missense	probably damaging	1.00
X0003:Npas3	UTSW	12	54044728	splice site	probably null
X0064:Npas3	UTSW	12	53354384	missense	probably damaging	0.96
Z1176:Npas3	UTSW	12	53501180	missense	probably damaging	0.99
Z1177:Npas3	UTSW	12	53947206	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACTCCTTGCTGTACACTGGG -3'
(R):5'- CGTTGCTGTAGACTGGGAAG -3'

Sequencing Primer
(F):5'- AGGCCCTGCAGAGGTTG -3'
(R):5'- CTGTAGACTGGGAAGGGCAGC -3'

Posted On

2016-07-22