Incidental Mutation 'R5302:Nid2'
List |< first << previous [record 25 of 42] next >> last >|
ID404317
Institutional Source Beutler Lab
Gene Symbol Nid2
Ensembl Gene ENSMUSG00000021806
Gene Namenidogen 2
Synonymsentactin 2, entactin-2
MMRRC Submission 042885-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R5302 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location19751265-19811787 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19779701 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 687 (T687A)
Ref Sequence ENSEMBL: ENSMUSP00000022340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022340]
Predicted Effect probably benign
Transcript: ENSMUST00000022340
AA Change: T687A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022340
Gene: ENSMUSG00000021806
AA Change: T687A

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Blast:NIDO 39 77 3e-11 BLAST
NIDO 108 276 1.12e-72 SMART
low complexity region 421 430 N/A INTRINSIC
low complexity region 452 470 N/A INTRINSIC
EGF 510 547 1.84e1 SMART
G2F 548 780 4.36e-143 SMART
EGF 785 823 2.52e-2 SMART
EGF_CA 824 866 1.45e-11 SMART
EGF 874 914 3.15e-3 SMART
EGF_CA 915 953 5.03e-11 SMART
TY 988 1037 8.27e-20 SMART
TY 1068 1116 1.19e-20 SMART
LY 1162 1204 1.15e-5 SMART
LY 1206 1248 8.82e-16 SMART
LY 1249 1293 1.51e-14 SMART
LY 1294 1336 3.56e-11 SMART
Predicted Effect unknown
Transcript: ENSMUST00000224263
AA Change: T421A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225791
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nidogen family of basement membrane proteins. This protein is a cell-adhesion protein that binds collagens I and IV and laminin and may be involved in maintaining the structure of the basement membrane.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a null alleleexhibit calcification of joint cartilage and osteoarthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,283,952 V1657A possibly damaging Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Acot5 A G 12: 84,073,441 Y190C probably damaging Het
Ascc3 T A 10: 50,707,777 Y941N probably benign Het
BC035947 A T 1: 78,511,962 M1K probably null Het
C2cd5 A G 6: 143,073,756 C278R probably benign Het
Cd200r1 G T 16: 44,792,809 L259F possibly damaging Het
Clcn4 A G 7: 7,294,051 V136A possibly damaging Het
Cntnap5a T C 1: 116,157,570 S413P probably benign Het
Corin T A 5: 72,316,098 E748D probably benign Het
Crtc2 G T 3: 90,261,018 G356V probably damaging Het
D1Pas1 T A 1: 186,969,445 Y524N probably damaging Het
Dlgap4 T C 2: 156,760,898 S147P probably damaging Het
Enpp1 A T 10: 24,651,390 I633N probably benign Het
Gm3095 A G 14: 3,964,498 D72G probably null Het
Gm5449 C T 13: 53,525,751 noncoding transcript Het
Gm6803 T A 12: 88,018,546 I76F probably damaging Het
Gpx7 T C 4: 108,400,914 T161A probably benign Het
Grip1 T C 10: 120,020,077 L236P probably damaging Het
H2-Q2 G T 17: 35,344,909 R255S probably damaging Het
Il17rc G T 6: 113,483,036 A648S possibly damaging Het
Klhl12 A G 1: 134,489,451 E540G possibly damaging Het
Mcm10 T C 2: 5,007,370 I135V probably benign Het
Mrps26 C A 2: 130,564,167 T100K probably benign Het
Npas3 A T 12: 54,068,836 D829V probably damaging Het
Ocln T C 13: 100,506,299 D176G probably damaging Het
Olfr745 A G 14: 50,642,319 probably null Het
Pax3 A C 1: 78,121,612 M380R possibly damaging Het
Pcdha3 A G 18: 36,948,155 E650G probably damaging Het
Pdcd11 C A 19: 47,107,644 H668N probably damaging Het
Polr3b T C 10: 84,699,400 Y858H possibly damaging Het
Pus10 T C 11: 23,667,416 probably null Het
Raver1 T C 9: 21,075,381 D739G probably damaging Het
Slc26a11 T C 11: 119,363,450 L198P probably damaging Het
Slc44a3 A G 3: 121,510,313 V258A probably damaging Het
Socs7 T A 11: 97,389,199 I524N probably damaging Het
Steap4 T A 5: 7,975,547 L36* probably null Het
Svep1 G C 4: 58,096,183 T1479S possibly damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Ttn C A 2: 76,717,275 V32184F probably damaging Het
Vmn1r22 T C 6: 57,900,975 N6D possibly damaging Het
Other mutations in Nid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Nid2 APN 14 19768677 missense probably benign
IGL01788:Nid2 APN 14 19807979 missense probably damaging 1.00
IGL02259:Nid2 APN 14 19768209 critical splice acceptor site probably null
IGL03084:Nid2 APN 14 19768932 missense probably benign 0.05
IGL03247:Nid2 APN 14 19779620 missense probably damaging 1.00
IGL03098:Nid2 UTSW 14 19805938 missense probably damaging 0.99
PIT4810001:Nid2 UTSW 14 19810090 missense possibly damaging 0.82
R0173:Nid2 UTSW 14 19802332 splice site probably benign
R0501:Nid2 UTSW 14 19789668 splice site probably null
R1117:Nid2 UTSW 14 19763664 critical splice acceptor site probably null
R1305:Nid2 UTSW 14 19768862 missense probably benign 0.00
R1572:Nid2 UTSW 14 19805412 missense probably benign 0.08
R1594:Nid2 UTSW 14 19781261 missense probably benign 0.03
R1789:Nid2 UTSW 14 19752431 missense possibly damaging 0.95
R1927:Nid2 UTSW 14 19768276 missense probably damaging 1.00
R2085:Nid2 UTSW 14 19778043 missense probably benign 0.12
R2086:Nid2 UTSW 14 19778043 missense probably benign 0.12
R2100:Nid2 UTSW 14 19778878 nonsense probably null
R2158:Nid2 UTSW 14 19778043 missense probably benign 0.12
R2240:Nid2 UTSW 14 19805914 missense probably damaging 0.99
R2314:Nid2 UTSW 14 19789761 missense probably benign 0.01
R2863:Nid2 UTSW 14 19768403 missense possibly damaging 0.92
R3113:Nid2 UTSW 14 19778043 missense probably benign 0.12
R3545:Nid2 UTSW 14 19763711 missense probably damaging 1.00
R3548:Nid2 UTSW 14 19763711 missense probably damaging 1.00
R3801:Nid2 UTSW 14 19809997 missense probably damaging 1.00
R4618:Nid2 UTSW 14 19808010 missense probably damaging 0.99
R4798:Nid2 UTSW 14 19789761 missense probably benign 0.01
R4953:Nid2 UTSW 14 19778078 nonsense probably null
R5256:Nid2 UTSW 14 19768208 critical splice acceptor site probably null
R5289:Nid2 UTSW 14 19805311 missense possibly damaging 0.95
R5409:Nid2 UTSW 14 19805962 missense probably damaging 1.00
R5514:Nid2 UTSW 14 19802467 missense probably damaging 1.00
R6134:Nid2 UTSW 14 19778783 missense probably damaging 1.00
R6365:Nid2 UTSW 14 19803133 missense probably damaging 1.00
R6647:Nid2 UTSW 14 19802416 missense probably benign 0.04
R6758:Nid2 UTSW 14 19802483 missense probably damaging 1.00
R6882:Nid2 UTSW 14 19789707 missense probably damaging 1.00
R6893:Nid2 UTSW 14 19789787 missense probably benign 0.34
R7045:Nid2 UTSW 14 19779681 missense possibly damaging 0.94
R7392:Nid2 UTSW 14 19768656 missense probably benign 0.00
R7477:Nid2 UTSW 14 19805973 missense probably benign 0.09
R7515:Nid2 UTSW 14 19791567 missense probably benign 0.06
R7547:Nid2 UTSW 14 19797277 missense probably benign
R7594:Nid2 UTSW 14 19768723 missense probably benign 0.00
R7615:Nid2 UTSW 14 19802530 missense probably damaging 1.00
R7680:Nid2 UTSW 14 19779647 missense probably damaging 1.00
R8097:Nid2 UTSW 14 19798589 missense possibly damaging 0.77
R8167:Nid2 UTSW 14 19810063 missense possibly damaging 0.57
R8292:Nid2 UTSW 14 19768278 missense probably damaging 0.99
RF002:Nid2 UTSW 14 19751366 small deletion probably benign
RF016:Nid2 UTSW 14 19751363 small deletion probably benign
X0009:Nid2 UTSW 14 19802511 missense probably damaging 1.00
X0021:Nid2 UTSW 14 19768862 missense probably benign 0.00
X0026:Nid2 UTSW 14 19778131 missense probably damaging 0.96
Z1177:Nid2 UTSW 14 19789808 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGAGTTTCTGTCTCCTGCAG -3'
(R):5'- AGCACTCTGATCACCTGTATAC -3'

Sequencing Primer
(F):5'- GGTGCTACCTTTGTCCATGACG -3'
(R):5'- GTGTATACGTCCTAAAAACAAGAACG -3'
Posted On2016-07-22