Incidental Mutation 'R5302:H2-Q2'
ID404320
Institutional Source Beutler Lab
Gene Symbol H2-Q2
Ensembl Gene ENSMUSG00000091705
Gene Namehistocompatibility 2, Q region locus 2
SynonymsH-2Q2, Gm11132
MMRRC Submission 042885-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R5302 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location35342242-35346762 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 35344909 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 255 (R255S)
Ref Sequence ENSEMBL: ENSMUSP00000078138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074806]
Predicted Effect probably damaging
Transcript: ENSMUST00000074806
AA Change: R255S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078138
Gene: ENSMUSG00000091705
AA Change: R255S

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:MHC_I 22 200 2.4e-90 PFAM
IGc1 219 290 4.05e-22 SMART
low complexity region 306 325 N/A INTRINSIC
Pfam:MHC_I_C 334 358 1.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173115
SMART Domains Protein: ENSMUSP00000133989
Gene: ENSMUSG00000091705

DomainStartEndE-ValueType
SCOP:d1hdma1 2 19 5e-6 SMART
low complexity region 22 41 N/A INTRINSIC
Pfam:MHC_I_C 50 74 1.5e-10 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,283,952 V1657A possibly damaging Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Acot5 A G 12: 84,073,441 Y190C probably damaging Het
Ascc3 T A 10: 50,707,777 Y941N probably benign Het
BC035947 A T 1: 78,511,962 M1K probably null Het
C2cd5 A G 6: 143,073,756 C278R probably benign Het
Cd200r1 G T 16: 44,792,809 L259F possibly damaging Het
Clcn4 A G 7: 7,294,051 V136A possibly damaging Het
Cntnap5a T C 1: 116,157,570 S413P probably benign Het
Corin T A 5: 72,316,098 E748D probably benign Het
Crtc2 G T 3: 90,261,018 G356V probably damaging Het
D1Pas1 T A 1: 186,969,445 Y524N probably damaging Het
Dlgap4 T C 2: 156,760,898 S147P probably damaging Het
Enpp1 A T 10: 24,651,390 I633N probably benign Het
Gm3095 A G 14: 3,964,498 D72G probably null Het
Gm5449 C T 13: 53,525,751 noncoding transcript Het
Gm6803 T A 12: 88,018,546 I76F probably damaging Het
Gpx7 T C 4: 108,400,914 T161A probably benign Het
Grip1 T C 10: 120,020,077 L236P probably damaging Het
Il17rc G T 6: 113,483,036 A648S possibly damaging Het
Klhl12 A G 1: 134,489,451 E540G possibly damaging Het
Mcm10 T C 2: 5,007,370 I135V probably benign Het
Mrps26 C A 2: 130,564,167 T100K probably benign Het
Nid2 A G 14: 19,779,701 T687A probably benign Het
Npas3 A T 12: 54,068,836 D829V probably damaging Het
Ocln T C 13: 100,506,299 D176G probably damaging Het
Olfr745 A G 14: 50,642,319 probably null Het
Pax3 A C 1: 78,121,612 M380R possibly damaging Het
Pcdha3 A G 18: 36,948,155 E650G probably damaging Het
Pdcd11 C A 19: 47,107,644 H668N probably damaging Het
Polr3b T C 10: 84,699,400 Y858H possibly damaging Het
Pus10 T C 11: 23,667,416 probably null Het
Raver1 T C 9: 21,075,381 D739G probably damaging Het
Slc26a11 T C 11: 119,363,450 L198P probably damaging Het
Slc44a3 A G 3: 121,510,313 V258A probably damaging Het
Socs7 T A 11: 97,389,199 I524N probably damaging Het
Steap4 T A 5: 7,975,547 L36* probably null Het
Svep1 G C 4: 58,096,183 T1479S possibly damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Ttn C A 2: 76,717,275 V32184F probably damaging Het
Vmn1r22 T C 6: 57,900,975 N6D possibly damaging Het
Other mutations in H2-Q2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00962:H2-Q2 APN 17 35342849 missense probably damaging 1.00
IGL01148:H2-Q2 APN 17 35342678 missense probably damaging 1.00
IGL02081:H2-Q2 APN 17 35342708 missense probably damaging 1.00
IGL03406:H2-Q2 APN 17 35342825 missense probably benign 0.01
R0145:H2-Q2 UTSW 17 35345176 missense probably benign 0.24
R0646:H2-Q2 UTSW 17 35345685 missense probably damaging 1.00
R1889:H2-Q2 UTSW 17 35345176 missense probably benign 0.24
R2055:H2-Q2 UTSW 17 35345271 missense probably benign 0.00
R2152:H2-Q2 UTSW 17 35345276 critical splice donor site probably null
R3898:H2-Q2 UTSW 17 35342767 missense probably damaging 1.00
R4710:H2-Q2 UTSW 17 35343302 missense probably damaging 1.00
R5267:H2-Q2 UTSW 17 35343179 missense probably benign 0.21
R6134:H2-Q2 UTSW 17 35343241 missense probably damaging 0.98
R6453:H2-Q2 UTSW 17 35344895 missense probably benign 0.07
R6633:H2-Q2 UTSW 17 35342387 missense probably damaging 0.98
R6979:H2-Q2 UTSW 17 35345647 splice site probably null
R8248:H2-Q2 UTSW 17 35344865 missense probably benign
R8306:H2-Q2 UTSW 17 35342325 unclassified probably benign
Z1176:H2-Q2 UTSW 17 35345675 missense probably damaging 1.00
Z1177:H2-Q2 UTSW 17 35342342 missense unknown
Predicted Primers PCR Primer
(F):5'- CGACAGTTGTAGTGTCAAACAGAC -3'
(R):5'- GCAAAAGGCTCCAGCTTTCC -3'

Sequencing Primer
(F):5'- TCACTGTCATCATTGATTTAACTGAG -3'
(R):5'- AAAGGCTCCAGCTTTCCCTGAC -3'
Posted On2016-07-22